Speed genome editing by transient CRISPR/Cas9 targeting and large DNA fragment deletion

Luo, Jing; Lu, Liaoxun; Gu, Yanrong; Huang, Rong; Lin, Ge; Li, Saichao; Qi, Xinhui; Zheng, Wenping; Chao, Tianzhu; Qin, Zheng; Liang, Yinming; Zhang, Lichen

doi:10.1016/j.jbiotec.2018.06.308

Cited by 12 publications

(16 citation statements)

References 26 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To investigate the feasibility of genome editing, schistosome eggs were transfected with ribonucleoprotein particle (RNP) complexes and with lentiviral virions carrying the CRISPR/Cas9 components, in similar fashion to earlier reports in cell lines, tissues and entire organisms (Kosicki et al, 2017; Holmgaard et al, 2017; Yu et al, 2018; Luo et al, 2018). Delivery by RNPs facilitates immediate editing, although the short half-life of the RNP components may be disadvantageous.…”

Section: Discussionmentioning

confidence: 99%

Programmed genome editing of the omega-1 ribonuclease of the blood fluke, Schistosoma mansoni

Ittiprasert

Mann

Karinshak

et al. 2019

eLife

185

View full text Add to dashboard Cite

CRISPR/Cas9-based genome editing has yet to be reported in species of the Platyhelminthes. We tested this approach by targeting omega-1 (ω1) of Schistosoma mansoni as proof of principle. This secreted ribonuclease is crucial for Th2 polarization and granuloma formation. Schistosome eggs were exposed to Cas9 complexed with guide RNA complementary to ω1 by electroporation or by transduction with lentiviral particles. Some eggs were also transfected with a single stranded donor template. Sequences of amplicons from gene-edited parasites exhibited Cas9-catalyzed mutations including homology directed repaired alleles, and other analyses revealed depletion of ω1 transcripts and the ribonuclease. Gene-edited eggs failed to polarize Th2 cytokine responses in macrophage/T-cell co-cultures, while the volume of pulmonary granulomas surrounding ω1-mutated eggs following tail-vein injection into mice was vastly reduced. Knock-out of ω1 and the diminished levels of these cytokines following exposure showcase the novel application of programmed gene editing for functional genomics in schistosomes.

show abstract

Section: Discussionmentioning

confidence: 99%

Programmed genome editing of the omega-1 ribonuclease of the blood fluke, Schistosoma mansoni

Ittiprasert

Mann

Karinshak

et al. 2019

eLife

185

View full text Add to dashboard Cite

show abstract

“…The PWD copy of Cd44 were sequenced for cDNA, and we found 2 amino acid absence in comparison to B6 protein sequence (Supplementary Data Sheet S1). The guide RNA was prepared by IVT, and potential off-targets were analyzed using the CRISPOR software, as described previously (Luo et al, 2018). Before microinjection of the CRISPR/Cas9 machinery designed to specifically target Cd44 of PWD mice, fertilized eggs were prepared by superovulation of B6 female mice aged 4–6 weeks and fertilization with sperm cells from PWD male mice aged 10–12 weeks.…”

Section: Resultsmentioning

confidence: 99%

“…In theory, the Indels should only occur for the PWD allele of Cd44 , which possesses PAM sequences that are absent in B6 mice. To validate the consequence of genome editing by allele specific targeting, we sequenced all the DNA samples from mice which carried Indel mutations by TA cloning of the PCR products and Sanger sequencing (Luo et al, 2018). Indeed, the Indel mutations were stringently restricted to the PWD allele, and all the B6 alleles tested were completely intact (Figure 4F and Supplementary Table S3).…”

Section: Resultsmentioning

confidence: 99%

Precise and Rapid Validation of Candidate Gene by Allele Specific Knockout With CRISPR/Cas9 in Wild Mice

et al. 2019

Self Cite

View full text Add to dashboard Cite

It is a tempting goal to identify causative genes underlying phenotypic differences among inbred strains of mice, which is a huge reservoir of genetic resources to understand mammalian pathophysiology. In particular, the wild-derived mouse strains harbor enormous genetic variations that have been acquired during evolutionary divergence over 100s of 1000s of years. However, validating the genetic variation in non-classical strains was extremely difficult, until the advent of CRISPR/Cas9 genome editing tools. In this study, we first describe a T cell phenotype in both wild-derived PWD/PhJ parental mice and F1 hybrids, from a cross to C57BL/6 (B6) mice, and we isolate a genetic locus on Chr2, using linkage mapping and chromosome substitution mice. Importantly, we validate the identification of the functional gene controlling this T cell phenotype, Cd44 , by allele specific knockout of the PWD copy, leaving the B6 copy completely intact. Our experiments using F1 mice with a dominant phenotype, allowed rapid validation of candidate genes by designing sgRNA PAM sequences that only target the DNA of the PWD genome. We obtained 10 animals derived from B6 eggs fertilized with PWD sperm cells which were subjected to microinjection of CRISPR/Cas9 gene targeting machinery. In the newborns of F1 hybrids, 80% ( n = 10) had allele specific knockout of the candidate gene Cd44 of PWD origin, and no mice showed mistargeting of the B6 copy. In the resultant allele-specific knockout F1 mice, we observe full recovery of T cell phenotype. Therefore, our study provided a precise and rapid approach to functionally validate genes that could facilitate gene discovery in classic mouse genetics. More importantly, as we succeeded in genetic manipulation of mice, allele specific knockout could provide the possibility to inactivate disease alleles while keeping the normal allele of the gene intact in human cells.

show abstract

“…CAL-1 cell line was cultured in 1640 medium supplemented with 10% fetal bovine serum (FBS, HyClone), 100 units/ml penicillin, 100 µg/ml streptomycin, 1 mM sodium pyruvate (Gibco), 10 mM HEPES (Gibco), 1% non-essential amino acid (100×, Millipore), 1% glutamine (100×, Gibco) and 0.1% b-mercaptoethanol (Sigma), incubated in % CO 2 at 37°C. To generate zDHHC2 −/− CAL-1 cell lines using CRISPR/Cas9 system, two sgRNAs (TCGCCTAAGAACTTCCTGATGGG, TATACCAGGACCA TGTCTGGAGG) were designed and synthesized for human zDHHC2 gene and respectively cloned into pX458 vector with EGFP which enabled single cell sorting as described previously (18). CAL-1 cells were co-electroporated with plasmids of px458-zDHHC2-sgRNA1 and px458-zDHHC2-sgRNA2 by using a Neon ® Transfection System (Thermo Fisher Scientific).…”

Section: Crispr/cas9 Mediated Knockout Of Zdhhc2 In Cal-1 Cellsmentioning

confidence: 99%

Zdhhc2 Is Essential for Plasmacytoid Dendritic Cells Mediated Inflammatory Response in Psoriasis

Zhou

Yang

et al. 2021

Front. Immunol.

Self Cite

View full text Add to dashboard Cite

Zdhhc family genes are composed of 24 members that regulate palmitoylation, a post-translational modification process for proteins. Mutations in genes that alter palmitoylation or de-palmitoylation could result in neurodegenerative diseases and inflammatory disorders. In this study, we found that Zdhhc2 was robustly induced in psoriatic skin and loss of Zdhhc2 in mice by CRISPR/Cas9 dramatically inhibited pathology of the ear skin following imiquimod treatment. As psoriasis is an inflammatory disorder, we analyzed tissue infiltrating immune cells and cytokine production. Strikingly we found that a master psoriatic cytokine interferon-α (IFN-α) in the lesioned skin of wildtype (WT) mice was 23-fold higher than that in Zdhhc2 deficient counterparts. In addition, we found that CD45+ white blood cells (WBC) infiltrating in the skin of Zdhhc2 deficient mice were also significantly reduced. Amelioration in psoriasis and dramatically reduced inflammation of Zdhhc2 deficient mice led us to analyze the cellular components that were affected by loss of Zdhhc2. We found that imiquimod induced plasmacytoid dendritic cell (pDC) accumulation in psoriatic skin, spleen, and draining lymph nodes (DLN) were drastically decreased in Zdhhc2 deficient mice, and the expression of pDC activation marker CD80 also exhibited significantly inhibited in psoriatic skin. In further experiments, we confirmed the cell intrinsic effect of Zdhhc2 on pDCs as we found that loss of zDHHC2 in human CAL-1 pDC dampened both interferon regulatory factor 7 (IRF7) phosphorylation and IFN-α production. Therefore, we identified novel function of Zdhhc2 in controlling inflammatory response in psoriasis in mice and we also confirmed that crucial role of Zdhhc2 in pDCs by regulating IRF7 activity and production of the critical cytokine. Our results finding the dependence of IFN-α production on Zdhhc2 in inflamed murine skin and in human pDCs provide rationale for targeting this new molecule in treatment of inflammation.

show abstract

Speed genome editing by transient CRISPR/Cas9 targeting and large DNA fragment deletion

Cited by 12 publications

References 26 publications

Programmed genome editing of the omega-1 ribonuclease of the blood fluke, Schistosoma mansoni

Programmed genome editing of the omega-1 ribonuclease of the blood fluke, Schistosoma mansoni

Precise and Rapid Validation of Candidate Gene by Allele Specific Knockout With CRISPR/Cas9 in Wild Mice

Zdhhc2 Is Essential for Plasmacytoid Dendritic Cells Mediated Inflammatory Response in Psoriasis

Contact Info

Product

Resources

About