Precise and Rapid Validation of Candidate Gene by Allele Specific Knockout With CRISPR/Cas9 in Wild Mice

Abstract

It is a tempting goal to identify causative genes underlying phenotypic differences among inbred strains of mice, which is a huge reservoir of genetic resources to understand mammalian pathophysiology. In particular, the wild-derived mouse strains harbor enormous genetic variations that have been acquired during evolutionary divergence over 100s of 1000s of years. However, validating the genetic variation in non-classical strains was extremely difficult, until the advent of CRISPR/Cas9 genome editing tools. In this study, we first describe a T cell phenotype in both wild-derived PWD/PhJ parental mice and F1 hybrids, from a cross to C57BL/6 (B6) mice, and we isolate a genetic locus on Chr2, using linkage mapping and chromosome substitution mice. Importantly, we validate the identification of the functional gene controlling this T cell phenotype, Cd44 , by allele specific knockout of the PWD copy, leaving the B6 copy completely intact. Our experiments using F1 mice with a dominant phenotype, allowed rapid validation of candidate genes by designing sgRNA PAM sequences that only target the DNA of the PWD genome. We obtained 10 animals derived from B6 eggs fertilized with PWD sperm cells which were subjected to microinjection of CRISPR/Cas9 gene targeting machinery. In the newborns of F1 hybrids, 80% ( n = 10) had allele specific knockout of the candidate gene Cd44 of PWD origin, and no mice showed mistargeting of the B6 copy. In the resultant allele-specific knockout F1 mice, we observe full recovery of T cell phenotype. Therefore, our study provided a precise and rapid approach to functionally validate genes that could facilitate gene discovery in classic mouse genetics. More importantly, as we succeeded in genetic manipulation of mice, allele specific knockout could provide the possibility to inactivate disease alleles while keeping the normal allele of the gene intact in human cells.

The pitfalls and virtues of population genetic summary statistics: Detecting selective sweeps in recent divergences

“…If available, candidate sweep regions could be analysed for overlap with quantitative trait loci in the same or related taxa (Jacobs et al., 2017; Stinchcombe & Hoekstra, 2008). Ultimately, while not currently feasible for most ecological and evolutionary non‐model organisms, the last step could involve validating candidate sweep regions, genes, and alleles, for example using analyses of gene expression (McGirr & Martin, 2018; Rahi et al., 2017), gene editing and knockouts (Chao et al., 2019; Fernandez i Marti & Dodd, 2018), or computational methods for predicting functional changes such as modified enzyme function or protein structure (Lee et al., 2017; Tang & Thomas, 2016). …”

Zdhhc2 Is Essential for Plasmacytoid Dendritic Cells Mediated Inflammatory Response in Psoriasis

“…For generation of Zdhhc2 −/− mice on the background of C57BL/6, two small guide RNAs (sgRNAs) (CAATGTTTGTCTGGTCATACTGG, TTGACACCCTAATGAAACGGAGG) were designed and synthesized according to our previous studies ( 14 , 15 ). In vitro fertilization was performed as described previously ( 16 , 17 ).…”

ATPIF1 inactivation promotes antitumor immunity through metabolic reprogramming of CD8+ T cells

“…The ATPIF1 knockout mouse was generated with the CRISPR/Cas9 gene editing method with sgRNA PAM sequences targeting ATPIF1: SgRNA-1 GCAGTCGGATAGCATGGATACGG and SgRNA-2 GGCTCCACCAGCTTCTCGGATGG. A similar method was described in our published study 40 . For identification of ATPIF1 -/mice, PCR was conducted to amplify the ATPIF1 gene using the Forward primer CATCAGCCTTGGAATTCTGC and the Reverse primer CTTCGTCTCGGACTCGGTAG.…”