Specificity of site directed psoralen addition to RNA

Abstract

We describe the attachment of a psoralen derivative (site specific psoralen, SSP) to the 5' end of a DNA oligonucleotide and the hybridization and the photoreaction of this reagent with a complementary target site on an RNA molecule. SSP was coupled to a variety of DNA oligonucleotides to investigate the structural requirements for addition to the RNA. Efficient SSP photoadducts were made on specific uridines by designing an intercalation site at an unpaired nucleotide in the RNA strand within the heteroduplex region. The optimal location for this site was five nucleotides from the oligonucleotide 5' end and just 5' to the target uridine residue. Because the attachment of the SSP to the oligonucleotide is through a disulfide bond, the DNA oligonucleotide can be removed with reduction to leave SSP attached to the RNA strand. The SSP adduct made in this way will be useful for subsequent biochemical and biophysical experiments.

Neighborhood of 16S rRNA nucleotides U788/U789 in the 30S ribosomal subunit determined by site-directed crosslinking

“…Scheme for targeting site-specific psoralen (SSP) to 16S rRNA positions U788/U789+ A: SSP in its reduced form (Saffran et al+, 1982)+ B: Sequence of target region in 16S rRNA (top strand) and deoxyoligonucleotide with SSP attached to the 59 phosphate through an aminoethanethiol (bottom strand)+ The sequence of the DNA was designed with 20 nt complementary to the RNA on the 59side of the target site, 4 nt complementary on the 59 side and a 1 nt bulge in the RNA on the 59 side of the target site+ C: Scheme for the placement of SSP into the 16S rRNA+ After hybridization of the SSP-DNA, a 1 1 2 _ min irradiation was used to phototransfer SSP to the RNA+ Reduction and electrophoresis through APM PAGE were then used to isolate the RNA that has the SSP group+ For some experiments, the SSP 16S rRNA was reacted with APAB before reconstitution+ tion of the psoralen 4959 bond (Cimino et al+, 1985)+ After the short irradiation, the sample was reduced with dithiothreitol (DTT) and electrophoresed on polyacrylamide gels containing N-acrylylaminophenyl mercuric chloride (APM, (Igloi, 1988)) to separate RNA containing the SSP from unreacted 16S rRNA and DNA-SSP+ The derivitized RNA was identified by phosphorimaging, and the SSP-RNA was isolated from the gel material by sedimentation through cesium chloride cushions (Wilms & Wollenzien, 1994)+ The efficiency of SSP addition was estimated to be 12-15% (not shown)+ It was also determined that the DNA oligonucleotide was completely removed from the RNA after reduction with DTT and electrophoresis under denaturing conditions (results not shown)+ The specificity of the monoaddition reaction was determined by primer extension analysis to be restricted to U788/ U789 region+ In primer extension experiments that used primers close to the monoaddition site, three stops of nearly equal intensity at A790, U789, and U788 were seen+ This is consistent with monoaddition at the 59 and 39 side of U788, to the 59 side of U789, and possibly also to the 39 side of U789 (Teare & Wollenzien, 1989)+ The electrophoretic purification on the APM-containing gels yields RNA that is nearly completely modified by the SSP at U788/U789+ Part of the sample was treated with azidophenacylbromide (APAB) to add the azidophenacyl (APA) moiety to the SH of SSP+ APA addition could be monitored on APM polyacrylamide gels (because APA addition reverses the retardation caused by free -SH groups) and was found to be .95%+ The 16S rRNA was incubated in reconstitution buffer for 10 min at 37 8C and then was reconstituted with protein from 30S subunits (TP30) according to the conditions of Krzyzosiak et al+ (1987)+ Reconstitution reactions were sedimented through sucrose gradients (Fig+ 2A) and showed peaks centered at 30S compared to native 30S particles but showed somewhat greater peak widths similar to the behavior of reconstituted synthetic 16S FIGURE 2. Purification and protein analysis of reconstituted subunits+ Reconstitution reactions, usually consisting of 200 mg control or modified 16S rRNA and fourfold molar equivalents of TP30 (20 equivalents total), were cooled to ice temperature and sedimented on linear 10-30% sucrose gradients made with activation buffer for the purification of the completely reconstituted 30S subunits+ A shows the gradient profile of reconstituted particles made with SSP25APA-modified 16S rRNA (diamonds) and from a parallel gradient the profile of native 30S subunits (squares)+ The position of 16S rRNA run in a parallel gradient is also shown+ The first ten fractions of the gradients are not shown+ The fractions within the brackets were combined to recover reconstituted particles+ B: Rever...…”

“…Reaction of psoralen at U788/U789 in 16S rRNA and reconstitution of the modified 16S rRNA Site-specific psoralen was covalently placed at a specific location in the 16S rRNA by irradiation of a complex containing 16S rRNA and the SSP linked to a DNA oligonucleotide complementary to the region of the target RNA+ For synthesis of the SSP-DNA, the DNA was reacted first with cystamine and purified, and then the cystamine-DNA was reduced so that the SSP could be added to it through a disulfide bond (Fig+ 1)+ The sequence of the DNA was designed so that when it is annealed to the RNA, it would cross the RNA target site (which needs to be a uridine) to create a favorable place for psoralen intercalation+ This arrangement was previously shown to be optimum for directing SSP reaction at its 49-59 double bond onto the uridine nucleotide next to the unpaired nucleotide in the hybrid structure (Teare & Wollenzien, 1989)+ The annealed complex was exposed to a 1 1 2 _ min irradiation with 320-380 nm light, resulting in preferential activa-FIGURE 1. Scheme for targeting site-specific psoralen (SSP) to 16S rRNA positions U788/U789+ A: SSP in its reduced form (Saffran et al+, 1982)+ B: Sequence of target region in 16S rRNA (top strand) and deoxyoligonucleotide with SSP attached to the 59 phosphate through an aminoethanethiol (bottom strand)+ The sequence of the DNA was designed with 20 nt complementary to the RNA on the 59side of the target site, 4 nt complementary on the 59 side and a 1 nt bulge in the RNA on the 59 side of the target site+ C: Scheme for the placement of SSP into the 16S rRNA+ After hybridization of the SSP-DNA, a 1 1 2 _ min irradiation was used to phototransfer SSP to the RNA+ Reduction and electrophoresis through APM PAGE were then used to isolate the RNA that has the SSP group+ For some experiments, the SSP 16S rRNA was reacted with APAB before reconstitution+ tion of the psoralen 4959 bond (Cimino et al+, 1985)+ After the short irradiation, the sample was reduced with dithiothreitol (DTT) and electrophoresed on polyacrylamide gels containing N-acrylylaminophenyl mercuric chloride (APM, (Igloi, 1988)) to separate RNA containing the SSP from unreacted 16S rRNA and DNA-SSP+ The derivitized RNA was identified by phosphorimaging, and the SSP-RNA was isolated from the gel material by sedimentation through cesium chloride cushions (Wilms & Wollenzien, 1994)+ The efficiency of SSP addition was estimated to be 12-15% (not shown)+ It was also determined that the DNA oligonucleotide was completely removed from the RNA after reduction with DTT and electrophoresis under denaturing conditions (results not shown)+ The specificity of the monoaddition reaction was determined by primer extension analysis to be restricted to U788/ U789 region+ In primer extension experiments that used primers close to the monoaddition site, three stops of nearly equal intensity at A790, U789, and U788 were seen+ This is consistent with monoaddition at the 59 and 39 side of U788, to the 59 side of U789, and possibly also to the 39 side of U789 (Teare & Wollenzien, 1989)+ The electrophoretic purification on the APM-containing gels yields RNA that is nearly completely modified by the SSP at U788/U789+ Part of the sample was treated with azidophenacylbromide (APAB) to add the azidophenacyl (APA) moiety to the SH of SSP+ APA addition could be monitored on APM polyacrylamide gels (because APA addition reverses the retardation caused by free -SH groups) and was found to be .95%+ The 16S rRNA was incubated in reconstitution buffer for 10 min at 37 8C and then was reconstituted with protein from 30S subunits (TP30) according to the conditions of …”

“…Frozen E. coli MRE 600 ( 1 2 _ log) cells were obtained from the Cell Culture Fermentation Facility, University of Alabama, Birmingham+ 70S ribosomes were prepared according to Makhno et al+ (1988), except that washed 70S ribosomes were used for the isolation of ribosomal subunits+ 70S ribosomes were dissolved in 20 mM Tris, pH 7+5, 200 mM NH 4 OAc, 3 mM Mg(OAc) 2 , 2 mM DTT and were incubated at 37 8C for 15 min to accomplish subunit dissociation (Makhno et al+, 1988) and were separated in sucrose gradients in the same buffer+ Subunits were dissolved in activation buffer (200 mM NH 4 Cl, 20 mM MgCl 2 , 20 mM Tris-HCl, pH 7+5, 2 mM DTT, Zamir et al+, 1973) and activated before freezing for storage+ Total protein from 30S ribosomal subunits was obtained by the method described by Nierhaus and Dohme (1979)+ It was dialyzed into reconstitution buffer (20 mM HEPES, pH 7+5, 400 mM NH 4 Cl, 20 mM Mg(OAc) 2 , 4 mM mercaptoethanol, Krzyzosiak et al+, 1987) and stored frozen in aliquots+ Preparation of SSP-modified RNA and reconstitution into 30S subunits SSP (Saffran et al+, 1982, obtained from Cerus Corp+, Concord, California) was attached to the 59-end of deoxyoligonucleotide pCTAACCTGTTTGCTCCCCACGCTT through a cystamine moiety through a reversible disulfide bond as previously described (Teare & Wollenzien, 1989)+ The purification of the cystamine oligonucleotide and of the final product (SSPoligonucleotide) were carried out by reversed phase HPLC using a PRP-1 column (Hamilton, 0+41 ϫ 15 cm) and, with 50 mM triethylamine acetate, pH 7+5 in both phases, a gradient in acetonitrile concentration from 8 to 32% run from 5 to 35 min+ After purification, the SSP-oligonucleotide was lyophilized and redissolved in water+ The hybridization of SSP-oligonucleotide and 16S rRNA was performed at 1:1 molar ratio in a buffer containing 1 ϫ TE, 0+1 M NaCl (TE is 0+01 M Tris-HCl, pH7+5, 1 mM EDTA) for 10 min at 45 8C, followed by incubation on ice for 10 min+ Usually 4 mg of 16S rRNA with 8 nmol SSPoligonucleotide were hybridized in 600 ml total volume+ Irradiation was at 320-360 nm for 1+5 min at 4 8C using a device that uses a mercury lamp and a circulating Co(NO 3 ) 2 solution to remove far-UV light below 320 nm (Isaacs et al+, 1977)+ This device has an estimated intensity of 200 mW/cm 2 + The short irradiation preferentially activates the 4959 furan-side reactive bond (Cimino et al+, 1985)+ After this irradiation, the sample was ethanol precipitated, redissolved in 800 ml of a buffer containing 1 ϫ TE, 7 M urea and then was reduced by adding DTT to a final concentration of 10 mM and incubating for 10 min at 37 8C+ The samples were then subjected to electrophoresis on a 4% polyacrylamide gel containing APM(Igloi, 1988)+ Electrophoresis was at 200 V (12+5 V/cm) at 45 8C for 5 h in a thermostatted apparatus+ SSP-containing 16S rRNA is greatly retarded on such a gel because of the sulfhydryl group it contains and migrates only few millimeters away from the well under this conditions+ The gel containing the RNA-SSP was cut out and the RNA-SSP was recovered by ultracentrifugation through cushions containing 2 M CsCl, 0+2 M EDTA, pH 7+4, 5 mM DTT for 20 h at 40K rpm (Wilms & Wollenzien, 1994), resuspended in 5 mM DTT, and ethanol precipitated+ The procedures of …”

“…Neighborhood of 16S rRNA nucleotides U788/U789 in the 30S ribosomal subunit determined by site-directed crosslinking INTRODUCTION The first secondary structure for the complete 16S rRNA was proposed in 1979 as a result of comparison of the Escherichia coli and Bacillus brevis sequences (Noller, 1980;Woese et al+, 1980)+ Since that time, the secondary structure has been confirmed and elaborated using the large number of sequences in the rRNA database and presently nearly all of the secondary structure base pairs and some tertiary structure base pairs are supported by sequence covariances (Gutell et al+, 1994)+ However, the 16S rRNA sequence comparison does not indicate many covariances between nucleotides distant in its secondary structure that would indicate its three dimensional structure+ Many different approaches have been used to obtain information pertaining to the rRNA higher order structure+ Biochemical experiments that have been most successful are (1) photoaffinity experiments, cleavage experiments, and footprinting experiments utilizing mRNA and tRNA (see Green & Noller, 1997) and (2) structural experiments involving the ribosomal proteins either to obtain footprints for the proteins (Stern et al+, 1989; or by using the proteins to carry cleavage reagents into the subunit Noller et al+, 1995)+ There would be several advantages to studying the rRNA structure with reagents that are in the rRNA+ The rRNA is a highly compact structure (Serdyuk et al+, 1983;Frank, 1997;Stark et al+, 1997), so there should be a high density of RNA-RNA contacts+ Changes in these may be correlated to changes in the ribosome structure, even if there are no changes in RNAribosomal protein contacts+ In addition, data from reporter reagents in the ribosome rather than in mRNA or tRNA substrates will be inherently simpler to use for molecular modeling, since the location and flexibility of the tRNA or mRNA does not have to be considered as part of the modeled structure+ UV light irradiation produces 15 long-range intramolecular crosslinks in the 16S rRNA (Wilms et al+, 1997)+ These provide some new information about its internal three dimensional arrangement and the crosslinking technique provides an opportunity to monitor conformational changes (Noah & Wollenzien, 1998)+ However, the relatively small number of UV crosslinks puts some limits on that approach+ In the present article we describe the use of site-directed crosslinking using a psoralen derivative as the photoreagent (Teare & Wollenzien, 1989)+ In this method, psoralen first is linked to an oligonucleotide, the psoralenoligonucleotide is annealed to the rRNA and the psoralen moiety is phototransferred to the RNA target site+ 16S rRNA containing the psoralen adduct is then purified and reconstituted into 30S subunits+ The advantages of the method are that all the 30S subunits contain psoralen, so the effects of the psoralen on the structure and function of the subunit can be determined independently of the experiments involving crosslinking...…”

Positions in the 30S ribosomal subunit proximal to the 790 loop as determined by phenanthroline cleavage

“…Unraveling the tertiary structure of rRNA within the ribosome remains a perplexing problem+ Recent efforts have utilized a number of techniques to ascertain accessible regions of rRNA (Noller & Herr, 1974;Stern et al+, 1989;Teare & Wollenzien, 1989;Hill et al+, 1990a;Noller et al+, 1990), relative positions of specific regions of rRNA (Stiege et al+, 1982(Stiege et al+, , 1986Brimacombe et al+, 1988), and detailed interactions between regions of rRNA and various ligands, such as mRNA (Lim et al+, 1992;Bogdanov et al+, 1993;Bhangu et al+, 1994;Huttenhofer & Noller, 1994;Bucklin et al+, 1997;Sergiev et al+, 1997), tRNA (Moazed & Noller, 1989Odom et al+, 1990;Dontsova et al+, 1992;Bullard et al+, 1995Bullard et al+, , 1998, nascent protein and the ribosome (Picking et al+, 1991;Hendrick et al+, 1993;Stade et al+, 1994Stade et al+, , 1995Choi & Brimacombe, 1998;Choi et al+, 1998), and antibiotics (Moazed & Noller, 1987;De Stasio et al+, 1989)+ Even though much information has been accumulated, details of the way in which the rRNA is folded within the ribosomal subunits remains obscure+ Using a chemical nuclease, iodoacetamido-1,10-phenanthroline (IoP; Fig+ 1), covalently attached to a short DNA oligomer complementary to the loop around nt 790, (787-795), we have harnessed the power of a chemical cleavage to help elucidate regions of rRNA proximal to a target site to a resolution of about 15 Å+ It would be ideal to attach IoP directly to a modified nucleotide within the rRNA itself, and, following cleavage, identify sites proximal to the modified nucleotide+ However, such site-specific modification of rRNA is not presently feasible+ In lieu of this, delivery of the IoP to a defined site within the ribosome can be accomplished by hybridizing a short, complementary DNA oligomer to a specific region within the rRNA+ Upon cleavage, other rRNA sites proximal to the bound phenanthroline can be identified+ There is ample evidence that IoP, covalently linked through a single 4-thiouracil residue to tRNA or mRNA in the presence of Cu(II) and a thiol reducing agent, creates a unique cleavage pattern in rRNA ...…”