Specific detection of Candida albicans and Candida tropicalis by fluorescent in situ hybridization with an 18S rRNA-targeted oligonucleotide probe

Lischewski, A.; Amann, Rudolf; Harmsen, Dag; Merkert, Hilde; Hacker, Jörg; Morschhäuser, Joachim

doi:10.1099/13500872-142-10-2731

Cited by 44 publications

(30 citation statements)

References 26 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In the future, it would be necessary to use a probe detecting the presence of C. albicans to quantify this bacterium when studying the efect of tetracycline on GIT microbiota. For this purpose, oligonucleotide 020 (5 'CCCCCTTTCCTAAACCAATCCGGA 3') can be used [28].…”

Section: Tetracyclinementioning

confidence: 99%

Influence of Selected Per Orally Administered ATB on Microflora of GIT in Experimental Animals

Maďar¹,

Tatiana²

2018

Antibiotic Use in Animals

View full text Add to dashboard Cite

Composition of gastrointestinal (GIT) microbiota difers in individual parts of GIT. Only 40% of GIT bacteria are cultivable. Fluorescence-in-situ-hybridization (FISH) can detect non-cultivable bacteria. Perorally administered antibiotics (ATB) afect the composition of microbiota in GIT. The absorbed ATB, namely penicillins, tetracyclines, macrolides or luorochinolons, have diferent inluence in comparison with poorly absorbed oral ATB, such as aminoglycosides, aminocoumarines or polypeptides. This efect is due to retention of high concentration of non-absorbed ATB during passage through GIT and their longer inluence on bacteria living in diferent parts of GIT. Study methods were based on scientiic literature review from PubMed, Elsevier databases and Slovak scientiic publications. We searched for publications between years 1980 and 2016, with keywords: ATB, inluence, microbiota, FISH. The literature review focuses on peroral administration of ATB to humans and animals and its potential efect on composition of GIT microbiota. The relevant studies showed that per orally administered ATB produced many important changes in microbiota of GIT. FISH method was more frequently used for screening the normal composition of microbiota than for studying the efects of ATB although there were some studies dealing also with this issue.

show abstract

Section: Tetracyclinementioning

confidence: 99%

Influence of Selected Per Orally Administered ATB on Microflora of GIT in Experimental Animals

Maďar¹,

Tatiana²

2018

Antibiotic Use in Animals

View full text Add to dashboard Cite

show abstract

“…Cell numbers were determined from one animal in each experiment. rRNA-targeted oligonucleotide probe can be used for the sensitive detection and identification of Candida species without the need for culture (12). In those pilot studies a probe that recognizes two medically important Candida species, C. albi- cans and C. tropicalis, was used.…”

Section: Discussionmentioning

confidence: 99%

“…RNA extraction and dot blot hybridizations were performed as described previously (12) by using a hybridization temperature of 43°C in a buffer containing 45% (vol/vol) formamide, which resulted in the specific binding of the oligonucleotide probes to their respective target regions in the 18S rRNA. (25) to ensure comparable vapor pressure, and hybridization was performed at 43°C for 2 h. The slides were gently rinsed with water and immersed in a prewarmed washing solution (40 mM NaCl, 20 mM Tris-HCl [pH 7.5], 0.01% [wt/vol] SDS, 5 mM EDTA) at 45°C for 20 min.…”

Section: Methodsmentioning

confidence: 99%

“…The reference strains C. albicans ATCC 44808 and C. parapsilosis DSM 70126 were used throughout this study. Additional strains from different Candida species which were used for RNA dot blot hybridization experiments have been described elsewhere (12 Oligonucleotide probes. The oligonucleotides used in this study were synthesized by MWG Biotech, Ebersberg, Germany.…”

Section: Methodsmentioning

confidence: 99%

“…Using a probe that binds to a target region in the 18S rRNA of C. albicans and Candida tropicalis, we have previously demonstrated that this method is applicable for the detection of different Candida species, irrespective of the morphological growth form (12). Under suitable hybridization conditions, the target organisms C. albicans and C. tropicalis were discriminated from all other clinically relevant Candida species, even the closely related species Candida parapsilosis, which contains a similar probe target region with only two nucleotide mismatches.…”

mentioning

confidence: 99%

See 2 more Smart Citations

Fluorescent in Situ Hybridization

Zheng¹,

Wu²

Encyclopedia of Genetics, Genomics, Proteomics and Informatics

View full text Add to dashboard Cite

Two 18S rRNA-targeted oligonucleotide probes specific for Candida albicans and Candida parapsilosis were used to detect and identify by fluorescent in situ hybridization these medically important Candida species in deep organs of mice after experimental systemic infection. The C. albicans-specific probe detected fungal cells in kidney, spleen, and brain sections of a mouse infected with C. albicans but not in a mouse infected with the closely related species C. parapsilosis. Conversely, the C. parapsilosis-specific probe detected fungal cells in the deep organs of a mouse infected with C. parapsilosis but not in the deep organs of a C. albicans-infected mouse. In addition, the C. albicans-specific probe was used to detect this species in human blood spiked with yeast cells by a lysis-filtration assay and subsequent fluorescent in situ hybridization. By this assay, as few as three yeast cells per 0.5 ml of blood were consistently detected. Our results demonstrate that fluorescent in situ hybridization with species-specific rRNA-targeted oligonucleotide probes provides a novel, culture-independent method for the sensitive detection and identification of Candida species in clinically relevant material.The opportunistic fungal pathogen Candida albicans and other species of the genus Candida are able to cause superficial and often fatal disseminated infections in immunocompromised patients. A clear-cut diagnosis is often difficult to obtain, and deep-seated candidiasis is in most cases only recognized postmortem. Disseminated candidiasis is usually diagnosed by blood culture, although blood cultures from patients with histologically proven disseminated candidiasis are often negative. In addition, even with an optimal blood culture system such as the lysis-centrifugation method, it takes a minimum of 1 to 2 days for detection and even longer for species identification (8). To reduce mortality in patients suffering from invasive candidiasis, early initiation of proper antifungal drug therapy is critical (2, 4). Because Candida species differ in their susceptibilities to widely used systemic antifungal agents, such as azoles (20), identification of the infecting species is important for ensuring effective therapeutic strategies. Direct histologic detection of the fungus in biopsy material from deep tissue offers the relatively best diagnostic assurance (11). The infecting species, however, cannot be identified by microscopic examination alone. Among other nonculture methods, like the less reliable detection of antigens or specific antibodies (19), PCR-based approaches for the detection of Candida infections have also been developed. Identification of the Candida species, however, relies on the application of one of a number of techniques which in most cases require additional steps after PCR (6, 9, 14-16, 21, 24, 26). The diagnostic value of these methods, however, remains to be established (19).Fluorescent in situ hybridization of whole cells with rRNAtargeted oligonucleotide probes has increasingly become a valuable t...

show abstract

A Photonic Crystal Protein Hydrogel Sensor for Candida albicans

et al. 2015

View full text Add to dashboard Cite

We report two-dimensional (2D) photonic crystal (PC) sensing materials that selectively detect Candida albicans (C.albicans). These sensors utilize Concanavalin A( Con A) protein hydrogels with a2 DP Ce mbedded on the Con A protein hydrogel surface,t hat multivalently and selectively bind to mannan on the C. albicans cell surface to form crosslinks.T he resulting crosslinks shrink the Con Ap rotein hydrogel, reduce the 2D PC particle spacing, and blue-shift the light diffracted from the PC.T he diffraction shifts can be visually monitored, measured with as pectrometer,o rd etermined from the Debye diffraction ring diameter.O ur unoptimized hydrogel sensor has adetection limit of around 32 CFU/ mL for C. albicans.T his sensor distinguishes between C. albicans and those microbes devoid of cell-surface mannan such as the gram-negative bacterium E. coli. This sensor provides aproof-of-concept for utilizing recognition between lectins and microbial cell surface carbohydrates to detect microorganisms in aqueous environments.

show abstract

Specific detection of Candida albicans and Candida tropicalis by fluorescent in situ hybridization with an 18S rRNA-targeted oligonucleotide probe

Cited by 44 publications

References 26 publications

Influence of Selected Per Orally Administered ATB on Microflora of GIT in Experimental Animals

Influence of Selected Per Orally Administered ATB on Microflora of GIT in Experimental Animals

Fluorescent in Situ Hybridization

A Photonic Crystal Protein Hydrogel Sensor for Candida albicans

Contact Info

Product

Resources

About