Species-specific identification of Mycobacterium bovis by PCR

Abstract

The Random Amplified Polymorphic DNA (RAPD) technique was used in the identification of a species-specific fragment of Mycobacterium bovis. A fragment of approximately 500 bp was amplified from the genome of 15 different M. bovis strains, including M. bovis BCG Pasteur, but was shown to be absent in 26 different mycobacteria and 20 different clinical isolates of Mycobacterium tuberculosis. When the fragment was used as a probe in a Southern blot analysis, several radioactive bands common to M. tuberculosis and M. bovis were observed. However, this fragment hybridized specifically to a 2900 bp EcoRl fragment in the M. bovis genome, but failed to hybridize in either M. tuberculosis or M. avium chromosomal DNA. Based on a partial nucleotide sequence of the 500 bp fragment, two oligonucleotide primers were designed and a PCR assay was developed. Using purified mycobacterial DNA samples, only M. bovis and M. bovis BCG rendered a unique amplification band. This PCR assay is able to detect down to 10 fg purified M. bovis DNA, which corresponds roughly to two bacilli. The assay is also useful for identifying the bacilli directly from uncultured biological samples, such as milk.

Identificação e genotipagem de Mycobacterium bovis em bovinos positivos no teste intradérmico para tuberculose em Mato Grosso do Sul

“…Portanto, a adição de mais um par de oligonucleotídeos com alvo para uma sequência diferente, como em uma mPCR, diminui a ocorrência destes resultados (Figueiredo et al 2010, Sales et al 2014. Cabe destacar que os oligonucleotídeos JB21/JB22 foram inicialmente propostos como específicos para M. bovis (Rodríguez et al 1995). No entanto, em estudo posterior, Rodríguez et al (1999) verificaram que algumas cepas de M. tuberculosis também podiam ser amplificadas por eles.…”

“…Os DNA obtidos foram submetidos a duas PCR multiplex (mPCR) de acordo com Figueiredo et al (2009). Em ambas foram empregados os oligonucleotídeos JB21 (5' TCGTCCGCTGATGCAAGTGC 3') e JB22 (5' CGTCCGCTGACCTCAAGAAG 3'), que amplificam um produto de 500 pares de base (pb) da sequência alvo rvd1rv2031c, para identificação de M. bovis (Rodríguez et al 1995). Na primeira m-PCR, foram incluídos os oligonucleotídeos TB11 (5' ACCAACGA-TGGTGTGTCCAT 3') e TB12 (5' CTTGTCGAACCGCATACCCT 3'), que amplificam um produto de 439 pb de hsp65, presente no gênero Mycobacterium spp.…”

A cross-sectional study on prevalence of bovine tuberculosis in Indian and crossbred cattle in Gangetic delta region of West Bengal, India

“…PCR amplification of some RD can distinguish between M. bovis and M. tuberculosis [28]. Besides, 500 bp fragment has also been reported to be M. bovis specific, located at 3' end of the putative gene called RvD1-Rv2031c [29]. Therefore, in this study, it was presumed that either M. tuberculosis or M. bovis would be present in milk and other antemortem samples.…”

Identification of mycobacterial infections in wild boars in Northern Sardinia, Italy

“…The IS900 nested PCR was performed as follows: the first PCR for 1 cycle, 3 min at 94 °, 40 sec at 94 °C, 40 sec at 57 °C and 40 sec at 72 °C for 25 cycles, using the primers IS900-1(5'-CT TTCTTGAAGGGTGTTCGG-3') and IS900-2 (5'-ACGTGACCTCGCCTCCAT), while the second PCR for 1 cycle, 3 min at 94 °, 40 sec at 94 °C, 40 sec at 61 °C and 40 sec at 72 °C for 35 cycles, using the primers IS900-3 (5'-ATGTGGTTGC TGTGTTGGATGG-3') and IS900-4 (5'-CCGCCGCAATCAACTCCAG-3'). A specific PCR for M. bovis was also performed based on the 500 bp fragment (Rodriguez et al, 1995). In this case it was a standard PCR.…”