Spatiotemporal Dynamics of Vibrio spp. within the Sydney Harbour Estuary

Abstract

Vibrio are a genus of marine bacteria that have substantial environmental and human health importance, and there is evidence that their impact may be increasing as a consequence of changing environmental conditions. We investigated the abundance and composition of the Vibrio community within the Sydney Harbour estuary, one of the most densely populated coastal areas in Australia, and a region currently experiencing rapidly changing environmental conditions. Using quantitative PCR (qPCR) and Vibrio-specific 16S rRNA amplicon sequencing approaches we observed significant spatial and seasonal variation in the abundance and composition of the Vibrio community. Total Vibrio spp. abundance, derived from qPCR analysis, was higher during the late summer than winter and within locations with mid-range salinity (5–26 ppt). In addition we targeted three clinically important pathogens: Vibrio cholerae, V. Vulnificus, and V. parahaemolyticus. While toxigenic strains of V. cholerae were not detected in any samples, non-toxigenic strains were detected in 71% of samples, spanning a salinity range of 0–37 ppt and were observed during both late summer and winter. In contrast, pathogenic V. vulnificus was only detected in 14% of samples, with its occurrence restricted to the late summer and a salinity range of 5–26 ppt. V. parahaemolyticus was not observed at any site or time point. A Vibrio-specific 16S rRNA amplicon sequencing approach revealed clear shifts in Vibrio community composition across sites and between seasons, with several Vibrio operational taxonomic units (OTUs) displaying marked spatial patterns and seasonal trends. Shifts in the composition of the Vibrio community between seasons were primarily driven by changes in temperature, salinity and NO2, while a range of factors including pH, salinity, dissolved oxygen (DO) and NOx (Nitrogen Oxides) explained the observed spatial variation. Our evidence for the presence of a spatiotemporally dynamic Vibrio community within Sydney Harbour is notable given the high levels of human use of this waterway, and the significant increases in seawater temperature predicted for this region.

Host‐microbiota interactions shed light on mortality events in the striped venus clam Chamelea gallina

“…Total bacteria specific primer pairs were the 16S_Fw—TCCTACGGGAGGCAGCAGT and 16S_Rev—GGACTACCAGGGTATCTAATCCTGTT, targeting the variable V3V4 loops for bacterial communities (Nadkarni, Martin, Jacques, & Hunter, ). Total Vibrio specific primer pairs were Vib1‐Fw GGCGTAAAGCGCATGCAGGT and Vib2‐Rev GAAATTCTACCCCCCTCTACAG (Siboni, Balaraju, Carney, Labbate, & Seymour, ), targeting the 16S rRNA of Vibrio genus. As a reference gene, we considered the universal 18S ribosomal RNA gene, using the specific primer pairs bivalve_uni_Fw CCGATAACGAACGAGACTC and bivalve_uni_Rev CACAGACCTGTTATTGCTC.…”

Vibrio and Bacterial Communities Across a Pollution Gradient in the Bay of Bengal: Unraveling Their Biogeochemical Drivers

“…The combination of copious amounts of organic matter from sewage and warmer temperatures favored likely the abundance of toxigenic V. cholerae during the pre-monsoon. Temperature is one of the most important drivers of the distribution of Vibrio and a strong predictor of Vibrio outbreaks (Huq et al, 2005;Siboni et al, 2016). Although the impact of sewage on main nutrients (e.g., ammonium and PON) was comparatively higher during the post-monsoon, its effect on ctxA abundance was not conspicuous.…”

First multi-year retrospective study on Vibrio parahaemolyticus and Vibrio vulnificus prevalence in Ruditapes philippinarum in Sacca di Goro, Italy

“…abundance (Siboni et al , 2016), and V. vulnificus abundance (Pfeffer et al , 2003), and a positive correlation with V. parahaemolyticus abundance (Parveen et al , 2008). This, notwithstanding, during our study dissolved oxygen varied from a minimum of 5.23 to a maximum of 14.49 mg/L, neither Vibrio spp.…”

“…Moreover, this group of organisms is increasing in abundance as a consequence of environmental perturbations and climate change (Siboni et al , 2016). According to the European Environmental Agency, the rise of global sea surface temperature is one of the major physical impacts of climate change, and in coastal European seas it has increased 4-7 times faster over the past few decades than in the global oceans (Reid et al , 2011).…”