Spatial genetic structure within a metallicolous population of Arabidopsis halleri, a clonal, self‐incompatible and heavy‐metal‐tolerant species

Abstract

Arabidopsis halleri, a close wild relative of A. thaliana, is a clonal, insect-pollinated herb tolerant to heavy metals (Zn, Pd, Cd) and a hyperaccumulator of Zn and Cd. It is of particular interest in the study of evolutionary processes and phytoremediation. However, little is known about its population gene flow patterns and the structure of its genetic diversity. We used five microsatellite loci to investigate the genetic structure at a fine spatial scale (10 cm to 500 m) in a metallicolous population of A. halleri. We also studied the contributions made by clonal propagation and sexual reproduction (seed and pollen dispersal) to the genetic patterns. Clonal diversity was high (D(G) > 0.9). Clonal spread occurs only at short distances (< 1 m). Both clonal spread and limited dispersal, associated with sexual reproduction, contribute to the significant spatial genetic structure revealed by spatial autocorrelation analysis. The shape of the autocorrelogram suggests that seed dispersal is restricted and pollen flow extensive, which may be related to intense activity by insect pollinators. Clonal spread was more extensive in the lowly polluted zone than in the highly polluted zone. This cannot be interpreted as a strategy for promoting the propagation of adapted genotypes under the harshest ecological constraints (highest heavy metal concentrations). The higher fine-scale spatial genetic structure found in the lowly polluted zone can be ascribed to plant densities that were lower than in the highly polluted zone. No evidence of genetic divergence due to spatial heavy metal heterogeneity was found between lowly and highly polluted zones.

Effect of balancing selection on spatial genetic structure within populations: theoretical investigations on the self-incompatibility locus and empirical studies in Arabidopsis halleri

“…Individuals of A. halleri may reproduce vegetatively through stolons (Van Rossum et al, 2004;Llaurens et al, 2008a). To avoid bias in estimates of SGS in relation to clonal reproduction, we considered ramets with identical multilocus genotypes at microsatellite loci as belonging to the same genet (noting that the distance between two identical multilocus genotypes never exceeded 1 m) and we discarded pairwise comparisons between those ramets.…”

“…We sampled 66 individuals at regular intervals along a 400 m transect and 68 and 28 individuals, respectively, within two plots of a 0.5 Â 3 m area. The Auby population is located in a site with high zinc content, due to soil pollution from the local mining industry (Van Rossum et al, 2004). In this very large population, we sampled 134 individuals along a 400 m transect and 76 individuals within a plot of a 0.5 Â 3 m area (see Van Rossum et al, 2004 for a description of the sampling procedure).…”

“…The Auby population is located in a site with high zinc content, due to soil pollution from the local mining industry (Van Rossum et al, 2004). In this very large population, we sampled 134 individuals along a 400 m transect and 76 individuals within a plot of a 0.5 Â 3 m area (see Van Rossum et al, 2004 for a description of the sampling procedure). In the population of Nivelle, we sampled exhaustively all individuals in about half of the population and in the other half we sampled individuals along a 30 m transect (364 individuals in total; see Llaurens et al, 2008a).…”

“…For the first 6 markers, GC22, H117, ICE113, MDC16, NGA112, NGA361, we used the same multiplex PCR procedure as in Auby. For LYR132, LYR133 and GC16, we used primers described in Van Rossum et al (2004), for ICE9, those described in Clauss et al (2002), and for LYR104, we used the following primers (courtesy of Thomas MitchellOlds: forward primer, GAGGCGAATGTAGTGGAAGG; reverse primer, CGACCTCCATCATCGATCTCAGCA). The reaction mixture (15 ml) contained 20 ng DNA, 1 Â buffer (Applied Biosystems), 2 mM of MgCl 2 , 200 mM of Fermentas dNTP mix, 200 mg ml À1 of bovine serum albumin, 0.2 mM of each microsatellite primer, 0.15 mM of M13 primer (fluorescence-labeled with either IRD-700 or IRD-800) and 0.025 U ml À1 of Taq PCR products were separated on 6% polyacrylamide gels and visualized through fluorescence of M13 primers on a Li-Cor sequencer (Les Ulis, France).…”

“…For the Auby population, DNA samples and genotypic data from five microsatellite loci (LYR132, LYR133, LYR417, GC16 and ATH) were already available (Van Rossum et al, 2004). We genotyped six additional microsatellite loci (GC22, H117, ICE13, MDC16, NGA112 and NGA361) using a multiplex PCR procedure, as described in Llaurens et al (2008a).…”