Solution Structure of a Parallel-stranded G-Quadruplex DNA

Binding of G-quadruplexes to the N-terminal Recognition Domain of the RNA Helicase Associated with AU-rich Element (RHAU)

“…Quadruplex Production and Purification-Synthetic hTR [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] RNA (5Ј-GGGUUGCGGAGGGUGGGCCU-3Ј, where the underlining highlights the guanines; Integrated DNA Technologies) was dissolved in 20 mM HEPES, pH 7.5, 100 mM KCl, 1 mM EDTA at a concentration of 5 M. RNA was heated to 95°C for 5 min, allowed to passively cool to room temperature outside the heat bath, and then purified by SEC on a HiLoad Superdex TM 75 26/60 size exclusion chromatography column (Ä KTA FPLC , GE Healthcare). Synthetic DNA quadruplexes (Alpha DNA, Canada) were dissolved in the above HEPES buffer but without adding EDTA, heated to 95°C, and allowed to cool slowly to room temperature inside the metal heat block or water bath.…”

“…All DNA synthesis batches exhibited the same result. Extinction coefficients (⑀ 260 nm ) were calculated from the sequence using IDT SciTools (PrimerQuest program, Integrated DNA Technologies) and corrected for hyperchromicity using the absorption spectra at 20 and 80°C: hTR [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] (22) and dsRNA (HIV-1 trans-activation response element, GGUCUCUCUGGUUAAGCCAGAUCUGAGCCUG-GGAGCUCUCUGGCUAACUAGGGAACC) (29) controls were used.…”

“…We next purified the DNA equivalent of hTR [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] (DNA [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] ) by SEC to compare it with its RNA counterpart. The procedure separated two distinct DNA conformations, suggesting that although both species have identical molecular weight they may differ slightly in terms of their solution conformation (Fig.…”

“…1A). To achieve effective separation, a large scale preparatory column was used that resolved two separate peaks: DNA 1-20 C1 (first eluted species) and DNA [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] C2 (second eluted species). Both DNA species migrated similarly and stained efficiently with quadruplex-specific dye ( Fig.…”

“…G-quadruplex structures spontaneously fold from RNA or DNA sequences containing consecutive runs of two or more adjacent guanines (G-tracts) and assemble into stable stacks of planar G-quartets that are stabilized by -stacking interactions (1)(2)(3)(4)(5)(6)(7). Quadruplexes are further stabilized by monovalent cations (typically K ϩ or Na ϩ ) that interact with guanine O6 oxygens at the center of the quadruplex (8).…”