Socotra Island the forgotten fragment of Gondwana: Unmasking chameleon lizard history with complete mitochondrial genomic data

ROBERTMACEY, J; Kuehl, Jennifer V.; Larson, Allan; Robinson, Michael D.; Uğurtaş, İsmail Hakkı; Ananjeva, Natalia B.; Rahman, H.; Javed, Hasnain; Osman, Rida; Doumma, Ali

doi:10.1016/j.ympev.2008.08.024

Cited by 38 publications

(19 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Although sea floor spreading in the Western portion of the Gulf of Aden is recent, Socotra is located substantially eastward, where rifting was complete ca 20 Ma [56][57][58][59]. The timing of divergence for C. monachus overlaps with the timing of separation between Socotra and Africa, and therefore, neither the isolation owing to vicariance nor oceanic dispersal [60] can be ruled out. The remaining three Asian taxa (Chamaeleo zeylanicus, Chamaeleo arabicus and Chamaeleo calyptratus) probably dispersed once from Africa to Arabia/Asia (ca 13 Ma), and thereafter diversified in situ (ca 6-8 Myr ago).…”

Section: Discussionmentioning

confidence: 99%

Large-scale phylogeny of chameleons suggests African origins and Eocene diversification

2013

View full text Add to dashboard Cite

Oceanic dispersal has emerged as an important factor contributing to biogeographic patterns in numerous taxa. Chameleons are a clear example of this, as they are primarily found in Africa and Madagascar, but the age of the family is post-Gondwanan break-up. A Malagasy origin for the family has been suggested, yet this hypothesis has not been tested using modern biogeographic methods with a dated phylogeny. To examine competing hypotheses of African and Malagasy origins, we generated a dated phylogeny using between six and 13 genetic markers, for up to 174 taxa representing greater than 90 per cent of all named species. Using three different ancestralstate reconstruction methods (Bayesian and likelihood approaches), we show that the family most probably originated in Africa, with two separate oceanic dispersals to Madagascar during the Palaeocene and the Oligocene, when prevailing oceanic currents would have favoured eastward dispersal. Diversification of genus-level clades took place in the Eocene, and species-level diversification occurred primarily in the Oligocene. Plio-Pleistocene speciation is rare, resulting in a phylogeny dominated by palaeo-endemic species. We suggest that contraction and fragmentation of the Pan-African forest coupled to an increase in open habitats (savannah, grassland, heathland), since the Oligocene played a key role in diversification of this group through vicariance.

show abstract

Section: Discussionmentioning

confidence: 99%

Large-scale phylogeny of chameleons suggests African origins and Eocene diversification

2013

View full text Add to dashboard Cite

show abstract

“…Macey et al [29] later added more than a dozen of chamaeleonid taxa mostly from genus Chamaeleo . In this study, we collected additional mitogenomic sequences from taxa that represent major groups of Agamidae and Chamaeleonidae.…”

Section: Introductionmentioning

confidence: 99%

Mitochondrial genomes of acrodont lizards: timing of gene rearrangements and phylogenetic and biogeographic implications

Okajima

Kumazawa

2010

BMC Evol Biol

View full text Add to dashboard Cite

BackgroundAcrodonta consists of Agamidae and Chamaeleonidae that have the characteristic acrodont dentition. These two families and Iguanidae sensu lato are members of infraorder Iguania. Phylogenetic relationships and historical biogeography of iguanian lizards still remain to be elucidated in spite of a number of morphological and molecular studies. This issue was addressed by sequencing complete mitochondrial genomes from 10 species that represent major lineages of acrodont lizards. This study also provided a good opportunity to compare molecular evolutionary modes of mitogenomes among different iguanian lineages.ResultsAcrodontan mitogenomes were found to be less conservative than iguanid counterparts with respect to gene arrangement features and rates of sequence evolution. Phylogenetic relationships were constructed with the mitogenomic sequence data and timing of gene rearrangements was inferred on it. The result suggested highly lineage-specific occurrence of several gene rearrangements, except for the translocation of the tRNAPro gene from the 5' to 3' side of the control region, which likely occurred independently in both agamine and chamaeleonid lineages. Phylogenetic analyses strongly suggested the monophyly of Agamidae in relation to Chamaeleonidae and the non-monophyly of traditional genus Chamaeleo within Chamaeleonidae. Uromastyx and Brookesia were suggested to be the earliest shoot-off of Agamidae and Chamaeleonidae, respectively. Together with the results of relaxed-clock dating analyses, our molecular phylogeny was used to infer the origin of Acrodonta and historical biogeography of its descendant lineages. Our molecular data favored Gondwanan origin of Acrodonta, vicariant divergence of Agamidae and Chamaeleonidae in the drifting India-Madagascar landmass, and migration of the Agamidae to Eurasia with the Indian subcontinent, although Laurasian origin of Acrodonta was not strictly ruled out.ConclusionsWe detected distinct modes of mitogenomic evolution among iguanian families. Agamidae was highlighted in including a number of lineage-specific mitochondrial gene rearrangements. The mitogenomic data provided a certain level of resolution in reconstructing acrodontan phylogeny, although there still remain ambiguous relationships. Our biogeographic implications shed a light on the previous hypothesis of Gondwanan origin of Acrodonta by adding some new evidence and concreteness.

show abstract

“…This magnitude of mtDNA sequence divergence drew our attention to the possibility that the two mtDNA clusters may be quite ancient (see below) and cryptic. Therefore, we compared whole mtDNA sequences from couples of the three closest ‘sister’ taxa of the genus Chamaeleo [16]. This revealed a mean of 990 mutations differentiating ‘sister’ taxa.…”

Section: Resultsmentioning

confidence: 99%

“…We identified two such restriction sites. First, we PCR amplified an 894 bp mtDNA fragment encompassing the identified restriction sites using the following primers: F-5′GCTGCCCCAATTTACTTCTG′ and R-5′ATCAAGGCCTACTAGTCCTG3′ (nucleotide positions 4148-4167 and 5042-5023, Genbank accession number EF222202.1, [16]). The fragment was digested using AseI (BioLabs cat # R0526S) and BsmAI (BioLabs cat # R0529S) in two separate reactions (Table S5).…”

Section: Methodsmentioning

confidence: 99%

“…Turkey) and inhabits Mediterranean habitats (Coastal Plain, Judean Mountains, Galilee and the Golan Heights) whereas the second taxon is confined to the sandy habitats of southern Israel including the north-western Negev and the Sinai peninsula [13], [14]. Recently five whole mtDNA sequences of chameleons belonging to the same species ( C. chamaeleon ) were sampled from distant geographic locations throughout the near east and Mediterranean basin including one from Portugal [15], two from Turkey, one from Cyprus, and one from Yemen [16]. These sequences exhibited a correlation between geographic distance and the degree of sequence divergence (i.e., isolation by distance).…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Mitochondrial DNA Variation, but Not Nuclear DNA, Sharply Divides Morphologically Identical Chameleons along an Ancient Geographic Barrier

et al. 2012

View full text Add to dashboard Cite

The Levant is an important migration bridge, harboring border-zones between Afrotropical and palearctic species. Accordingly, Chameleo chameleon, a common species throughout the Mediterranean basin, is morphologically divided in the southern Levant (Israel) into two subspecies, Chamaeleo chamaeleon recticrista (CCR) and C. c. musae (CCM). CCR mostly inhabits the Mediterranean climate (northern Israel), while CCM inhabits the sands of the north-western Negev Desert (southern Israel). AFLP analysis of 94 geographically well dispersed specimens indicated moderate genetic differentiation (PhiPT = 0.097), consistent with the classical division into the two subspecies, CCR and CCM. In contrast, sequence analysis of a 637 bp coding mitochondrial DNA (mtDNA) fragment revealed two distinct phylogenetic clusters which were not consistent with the morphological division: one mtDNA cluster consisted of CCR specimens collected in regions northern of the Jezreel Valley and another mtDNA cluster harboring specimens pertaining to both the CCR and CCM subspecies but collected southern of the Jezreel Valley. AMOVA indicated clear mtDNA differentiation between specimens collected northern and southern to the Jezreel Valley (PhiPT = 0.79), which was further supported by a very low coalescent-based estimate of effective migration rates. Whole chameleon mtDNA sequencing (∼17,400 bp) generated from 11 well dispersed geographic locations revealed 325 mutations sharply differentiating the two mtDNA clusters, suggesting a long allopatric history further supported by BEAST. This separation correlated temporally with the existence of an at least 1 million year old marine barrier at the Jezreel Valley exactly where the mtDNA clusters meet. We discuss possible involvement of gender-dependent life history differences in maintaining such mtDNA genetic differentiation and suggest that it reflects (ancient) local adaptation to mitochondrial-related traits.

show abstract

Socotra Island the forgotten fragment of Gondwana: Unmasking chameleon lizard history with complete mitochondrial genomic data

Cited by 38 publications

References 27 publications

Large-scale phylogeny of chameleons suggests African origins and Eocene diversification

Large-scale phylogeny of chameleons suggests African origins and Eocene diversification

Mitochondrial genomes of acrodont lizards: timing of gene rearrangements and phylogenetic and biogeographic implications

Mitochondrial DNA Variation, but Not Nuclear DNA, Sharply Divides Morphologically Identical Chameleons along an Ancient Geographic Barrier

Contact Info

Product

Resources

About