SNOntology: Myriads of novel snornas or just a mirage?

Abstract

BackgroundSmall nucleolar RNAs (snoRNAs) are a large group of non-coding RNAs (ncRNAs) that mainly guide 2'-O-methylation (C/D RNAs) and pseudouridylation (H/ACA RNAs) of ribosomal RNAs. The pattern of rRNA modifications and the set of snoRNAs that guide these modifications are conserved in vertebrates. Nearly all snoRNA genes in vertebrates are localized in introns of other genes and are processed from pre-mRNAs. Thus, the same promoter is used for the transcription of snoRNAs and host genes.ResultsThe series of studies by Dahai Zhu and coworkers on snoRNAs and their genes were critically considered. We present evidence that dozens of species-specific snoRNAs that they described in vertebrates are experimental artifacts resulting from the improper use of Northern hybridization. The snoRNA genes with putative intrinsic promoters that were supposed to be transcribed independently proved to contain numerous substitutions and are, most likely, pseudogenes. In some cases, they are localized within introns of overlooked host genes. Finally, an increased number of snoRNA genes in mammalian genomes described by Zhu and coworkers is also an artifact resulting from two mistakes. First, numerous mammalian snoRNA pseudogenes were considered as genes, whereas most of them are localized outside of host genes and contain substitutions that question their functionality. Second, Zhu and coworkers failed to identify many snoRNA genes in non-mammalian species. As an illustration, we present 1352 C/D snoRNA genes that we have identified and annotated in vertebrates.ConclusionsOur results demonstrate that conclusions based only on databases with automatically annotated ncRNAs can be erroneous. Special investigations aimed to distinguish true RNA genes from their pseudogenes should be done. Zhu and coworkers, as well as most other groups studying vertebrate snoRNAs, give new names to newly described homologs of human snoRNAs, which significantly complicates comparison between different species. It seems necessary to develop a uniform nomenclature for homologs of human snoRNAs in other vertebrates, e.g., human gene names prefixed with several-letter code denoting the vertebrate species.

H/ACA Box Small Nucleolar RNA 7A Promotes the Self-Renewal of Human Umbilical Cord Mesenchymal Stem Cells

“…Increasing evidences suggest that dysregulation of snoRNAs could contribute to fundamental aspects of human disease, tumor biology, development and other pathological events . Highly diverse roles of these snoRNAs were found or indicated, and is more actively involved in many biological events than previously thought . Among which, H/ACA box snoRNAs are reported to be related to a number of diseases such as X‐linked dyskeratosis congenita (X‐DC) , leukemia , lymphoma , and multiple myeloma .…”

Specific genomic cues regulate Cajal body assembly

“…60 Additionally, the current total number of reported target sn/snoRNA and scaRNA genes that are potentially targeted to, processed or sequestered in the CB is close to 1700 loci, although the exact number is under consideration. 61 These gene loci are located across the genome on all human chromosomes) and more are frequently being discovered and annotated. 62 We performed a simple but novel analysis by collecting the known locations of CB target genes from publicallyaccessible databases 63,64 and plotting their enrichment across the genome in discrete 1 Mbp bins (Fig.…”

Delivery of RNAi therapeutics: work in progress

“…However, this gap in understanding is sure to be bridged in time opening up massive new opportunities for miRNA-based RNAi therapeutics as well. Then again beyond the miRNA frontier lie prospects for other ncRNA-based RNAi therapeutic approaches based around other newly emerging ncRNA families such as small nucleolar RNAs, PIWI-interacting RNAs , long double-stranded RNAs, large intergenic noncoding RNAs and others [8][9][10][11][12][13]. Moreover, this revolution in understanding and opportunity may also breathe new life into the therapeutic potential of other already wellknown ncRNA families such as the antisense RNAs (asRNAs) and catalytic RNAs that have been mooted as potentially powerful therapeutic agents for many years now [14].…”

“…Anti-VEGF S 5´-UCGAGAAUCUAAACUAACUT*T-3Á S 3´-T*TAGCUCUUAGAUUUGAUUGA-51 9-mer siRNA helix; 2-base overhang on both strands S 5´-GCACAUAGGAGAGAUGAGCU*U-3Á S 3´-G*UCGUGUAUCCUCUCUACUCGA A-52 1-mer siRNA helix: one blunt end, 2-base overhang on 3´-AS [212] Semple et al Ssb-siRNA S 5´-BdACdAdACdAdGdACUUUdAdAUdGUdAdAdTdTB-3Á S 3´-UUUG U U G U C UGAAA U U A C A U U-51 9-mer siRNA helix; 2-base overhang on both strands [82] Underlined letter denotes the putative cleavage site residue position (11) in each antisense strand (AS) that acts as a guide strand, while each complementary sense strand (S) acts as the passenger strand [213]. …”