Simultaneous Detection and Survey of Three Rice Viruses in China

Abstract

Rice black-streaked dwarf virus, Rice stripe virus, and Southern rice black-streaked dwarf virus (SRBSDV) have been epidemic in large areas of China where rice is grown, causing significant losses of rice yield in recent years. These viral diseases sometimes occur in the same regions, and even in the same fields, making it difficult to detect and diagnose the viral pathogens. A set of primers specific to the genes encoding the capsid proteins of the three viruses were designed, and a multiple one-step reverse-transcription polymerase chain reaction protocol was developed. The method proved to be simple, rapid, and sensitive. It was used to detect the viruses in samples of rice, maize, small brown planthoppers, and white-backed planthoppers collected from different regions of China, showing that it is suitable for routine diagnosis. A simultaneous survey of the three viruses was further conducted by this method throughout Zhejiang Province, Eastern China. The results showed that both RBSDV and RSV had continued to spread and that the newly emerging virus, SRBSDV, was present in at least 27 counties or cities, suggesting that more effort is needed to monitor and control the threat from these three viral diseases.

Biology of Southern rice black‐streaked dwarf virus: a novel fijivirus emerging in East Asia

“…Following the completion of its genomic sequence, molecular methods have been developed to detect SRBSDV in plants to assess the viruliferous proportions of WBPH populations. These methods include duplex or multiple reverse transcription‐PCR (RT‐PCR; Wu et al ., ; Zhang et al ., ) and reverse transcription loop‐mediated isothermal amplification (RT‐LAMP; Zhou et al ., ). Using these methods, the distribution and genetic diversity of SRBSDV in China have been surveyed (Cheng et al ., ; Wu et al ., ), providing basic information for forecasting, preventing, and controlling the disease.…”

“…Since 2009, the viral disease has spread rapidly from south to north in the rice‐growing areas of eastern Asia, including Vietnam (Hoang et al ., ), China (Cheng et al ., ) and Japan (Matsukura et al ., ). In China, SRBSDV infection mainly occurs in the southern, central and eastern regions, including the provinces of Hainan (Wang et al ., ), Guangdong (Zhou et al ., ), Guangxi, Fujian (Liu et al ., ), Zhejiang (Wu et al ., ), Jiangsu (Cheng et al ., ), Anhui, Jiangxi, Hunan, Hubei, Sichuan, Guizhou and Yunnan, and cities of Shanghai and Chongqin (He et al ., ). Its distribution is thought to be associated with the migration of its insect vector, the white‐backed planthopper (WBPH, Sogatella furcifera ; Zhou et al ., ), and this is particularly supported by its spread overseas to Japan (Matsukura et al ., ).…”

Quantification of southern rice black streaked dwarf virus and rice black streaked dwarf virus in the organs of their vector and nonvector insect over time

“…Another primer pair, RBSDV-S4F (5 CATCAAAAAAGCCGGAAGCT3 ) and RBSDV-S4R (5 CAACCATGATCCCTGTAAGAATAAAA3 ), was designed to amplify this 140-bp fragment in a RT-qPCR, and primer pair RBSDV-S4F (5 TACTCGCCATGCTTGGTCTA3 ) and RBSDV-S4R (5 CAACGAAATCAACGCTCACT3 ) was developed using GenBank accession AJ293984.1 to amplify a 969-bp fragment from the S4 genomic segment in a conventional RT-PCR. Actin gene of WBPH and SBPH was amplified using universal degenerated primers designed by Wu et al (2013) ACT-1 (5 CCYGAYGGYCARGTRATCACMATTGG3 ) (Y = C,T; R = A,G; M = A,C) and ACT-2 5 -GAKATCCACATCTGYTGGAARGTG3 ) (K = G,T; Y = C,T; R = A,G) with expected length of 347-bp in conventional RT-PCR as internal control. In case of ZLH, 195-bp fragment of Co1 gene (accession LN681350.1) was amplified as internal control using primers ZLH-Co1F (5 CCTGATATAGCATTTCCCCG3 ) and ZLHCo1R (5 TCCTGCAAGATGGAGTGAAA3 ) in conventional RT-PCR.…”

Detection and diagnosis of rice-infecting viruses

“…Since the RT-PCR products derived from each virus differs in size, two viruses such as RDV/RSV, which are major rice viruses in Japan can be detected in a single reaction ( Figure 1C-c ). In rice fields of some countries where mixed infections with RRSV and RGSV, SRBSDV, and RSV and RBSDV, RSV and RBSDV, and RDV have been reported (Du et al, 2007; Cho et al, 2013; Wu et al, 2013b), multiplex RT-PCR is useful to rapidly and simultaneously identify the viruses.…”