Quantification of southern rice black streaked dwarf virus and rice black streaked dwarf virus in the organs of their vector and nonvector insect over time

Rice Reoviruses in Insect Vectors

“…Whether salivary components are necessary for viral infection in plant hosts is still unknown. A certain threshold of accumulation of rice reoviruses in the salivary glands is positively correlated with transmission efficiency by insect vectors (36). We thus deduce that rice reoviruses may use the intracellular canaliculi in the salivary glands for the rapid dissemination of viruses into plants.…”

“…Indeed, the small interfering RNA (siRNA) antiviral pathway, a major innate immune response, is triggered by the persistent infection of rice reoviruses in respective vectors (57,58,60,124). Quantification of SRBSDV accumulation in the competent vector S. furcifera and incompetent vector L. striatellus has identified a clear threshold titer for a certain insect to be able to transmit the virus (6,36,70). SRBSDV is exclusively restricted to the intestinal epithelium of the incompetent L. striatellus (45).…”

Screening of rice (Oryza sativa) cultivars for resistance to rice black streaked dwarf virus using quantitative PCR and visual disease assessment

“…In order to confirm symptoms of RBSDD after 30 days of inoculation, total RNA was extracted from randomly collected leaves of positive control Huaidao 5 using TRIzol (Invitrogen) following the manufacturer's instructions. The 969 bp band from the S4 genomic segment of RBSDV was amplified in RT‐PCR and the percentage of infected rice plants was calculated as previously described (Hajano et al ., ). In greenhouse experiments, plants were evaluated for disease severity based on the percentage of plants showing stunting with dark green leaves at 30 days after transplanting, using the following disease rating scale: 0 = no symptoms, 1 = 1–10%, 3 = 11–30%, 5 = 31–50%, 7 = 51–70% and 9 = 71–100% of plants with stunting and dark green colour (IRRI, ).…”

“…Two microlitres of cDNA were used to amplify the 140 bp fragment of RBSDV in a final volume of 20 μ L of Premix EX Taq (probe qPCR) master mix according to the instructions (Takara) in an ABI 7500 real‐time PCR system (Applied Biosystems). Previously prepared plasmid DNA of RBSDV was serially diluted and was run in parallel to prepare a standard curve ranging from 10 2 to 10 7 copies (Hajano et al ., ). PCR cycling consisted of an initial denaturation of 30 s at 95 °C; then 40 cycles of 5 s at 95 °C, annealing and extension for 34 s at 60 °C.…”

“…Approximately 1000 ng of total RNA was converted into cDNA using PrimeScript RT reagent kit with gDNA Eraser (Perfect Real Time; Takara). Primers designed in a previous study (Hajano et al ., ), RBSDV‐S4F (5′‐CATCAAAAAAGCCGGAAGCT‐3′) and RBSDV‐S4R (5′‐CAACCATGATCCCTGTAAGAATAAAA‐3′), with expected length of 140 bp, were used to amplify the S4 genomic segment of RBSDV in RT‐qPCR. The probe RBSDV‐S4P (5′‐CGTCACTTTACCATTTGCTTGGCGACA‐3′) was designed for fluorescence detection using the same nucleotide sequence that was used for primer design (accession AJ409146.1).…”