Simultaneous analysis of interleukin-10 gene microsatellites and single-nucleotide polymorphisms in parallel with tumour necrosis factor and interferon-gamma short tandem repeats by fluorescence-based polymerase chain reaction

Mosaics of gene variations in the Interleukin-10 gene promoter affect interleukin-10 production depending on the stimulation used

“…in relation to IL-10 in vitro responses Within the recently described multiplex assay, we introduced a modification allowing to identify directly the association of -1087A/G gene variations with corresponding IL10.G alleles located directly 5' from this gene locus and compare this haplotype with differentially regulated IL-10 expression (Figure 3) (Table 5). 33 In combination with our in vitro stimulation assay two striking observations can be made: first, that the alleles IL10.G10, G12 and G14 (22, 24 and 26 dinucleotide repeats, respectively) are related to higher amounts of IL-10 after LPS stimulation compared to all other haplotypes ( Figure 3). Second, the influence of the alleles A or G of the SNP -1087 is also evident when analysed as a haplotype with the microsatellite IL10.G (Figure 3a).…”

“…33 Determination of new distal haplotypes of the 5 0 -flanking region of the IL-10 gene To determine first the distal IL-10 promoter haplotypes for the SNPs -6208 C/G and -6752 A/T a cohort of 204 Caucasian donors was genotyped by multiplex-PCR. Considering the distal haplotype comprising the SNPs -6752 A/T and -6208 C/G three major haplotypes TC, AG and AC were observed ( Table 1).…”

“…33 DNA probes from healthy African or Vietnamese volunteers were isolated by the same procedure and were described previously. 36,37 Peripheral blood mononuclear cells, cell culture and cell stimulation PBMC were isolated from buffy coats using Ficoll separating solution (Pharmacia Biotech, Freiburg, Germany).…”

“…33 Briefly the modifications were as following instead of primers to detect IL10.G microsatellites a set of fluorescence-labelled primers with corresponding allele mismatches at the 3 0 -ends for the SNP -1087A/G were used allowing the simultaneous detection of SNP and microsatellite lengths. In addition, we introduced primers to analyse gene variations at À824C/T and -2736C/G.…”

“…The primers used were described recently, newly designed primers are shown in Table 6. 33,37 Genetic data were analysed using GENEPOP software. 38 Analysis included tests for Hardy-Weinberg equilibrium, genotypic and allelic differentation between the two groups as well as for the data of expected vs TACCCTTGTACAGGTGATGTAAC FAM IL-10-824T TACCCTTGTACAGGTGATGTAAT HEX IL-10 824 TAGTCTGCACTTGCTGAAAGCTT -IL-10-1087A CTTACCTTCCCTACTTCCGCT FAM IL-10-1087G CTTACCTTCCCTACTTCCGCC HEX IL-10-1087 GTTTCTGTCAACACTCCTCGCCGCAACCCA -IL-10-2736A GCGCCTGGCACCACGCCCGTCTAAT FAM IL-10-2736C GCGCCTGGCACCACGCCCGTCTAAG HEX IL-10-2736 GTTTCTGGGTCCCTTACTTTCCTCTTACCTATCC -All other oligonucleotides used in this study were described recently.…”