Short single strand DNA detection by means of Lossy Mode Resonance based fiber-optic sensor

Zubiate, Pablo; Ciaurriz, Paula; Tellechea, Edurne; Santano, Desiree; Villar, Ignacio Del; Urrutia, Aitor; Arregui, Francisco J.; Matı́as, Ignacio R.; Zamarreño, Carlos R.

doi:10.1109/sensors43011.2019.8956557

Cited by 3 publications

(4 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…There are many applications where LMR-based sensors have been used for the detection of different parameters such as humidity sensors, pH sensors, volatile organic compound sensors, gas sensors, chemical sensors or biosensors [16][17][18][19][20][21][22][23]. Furthermore, LMR technology has gone beyond the limits of sensors to enter other areas, such as the design and implementation of electro-optically modulated devices [24] and the detection of electroactive species [25][26].…”

Section: Some Advances In the Lmr Technologymentioning

confidence: 99%

Advances in sensors using lossy mode resonances

Matias

2023

Advanced Sensor Systems and Applications XIII

View full text Add to dashboard Cite

Section: Some Advances In the Lmr Technologymentioning

confidence: 99%

Advances in sensors using lossy mode resonances

Matias

2023

Advanced Sensor Systems and Applications XIII

View full text Add to dashboard Cite

“…LMRs are not a technology as mature as SPRs [95], but their high sensitivity compared to SPRs [122,123] has already led to the development of biosensors that enable miRNA detection such as hsa-miR-34b-5p (UAGGCAGUGUCAUUAGCUGAUUG, also known as miR-34b) [124] and has-miR-223-3p (UGUCAGUUUGUCAAAUACCCCA, also known as miR-223) [125], although further research is required. Both of them are linked with RA, miR-34b is overexpressed in RA T cells [34]; while increased serum miR-223 levels are considered to be connected with higher disease activity and disease relapse [33].…”

Section: Resonance-based Biosensorsmentioning

confidence: 99%

Optical Biosensors for the Detection of Rheumatoid Arthritis (RA) Biomarkers: A Comprehensive Review

Imas

Zamarreño

Zubiate

et al. 2020

Sensors

View full text Add to dashboard Cite

A comprehensive review of optical biosensors for the detection of biomarkers associated with rheumatoid arthritis (RA) is presented here, including microRNAs (miRNAs), C-reactive protein (CRP), rheumatoid factor (RF), anti-citrullinated protein antibodies (ACPA), interleukin-6 (IL-6) and histidine, which are biomarkers that enable RA detection and/or monitoring. An overview of the different optical biosensors (based on fluorescence, plasmon resonances, interferometry, surface-enhanced Raman spectroscopy (SERS) among other optical techniques) used to detect these biomarkers is given, describing their performance and main characteristics (limit of detection (LOD) and dynamic range), as well as the connection between the respective biomarker and rheumatoid arthritis. It has been observed that the relationship between the corresponding biomarker and rheumatoid arthritis tends to be obviated most of the time when explaining the mechanism of the optical biosensor, which forces the researcher to look for further information about the biomarker. This review work attempts to establish a clear association between optical sensors and rheumatoid arthritis biomarkers as well as to be an easy-to-use tool for the researchers working in this field.

show abstract

“…One of the most common applications in the case of LMR-based sensors has been the development of refractometers [17,18,39,40]. Nevertheless, there are also other applications including gas detection [41][42][43][44][45], humidity sensors [46][47][48][49], pH sensors [50][51][52], or biosensors [53][54][55][56][57][58].…”

Section: Applicationsmentioning

confidence: 99%

“…LMR based biosensors have also been utilized for detecting miRNAs, which are small and non-coding RNAs (ribonucleic acids) involved in the regulation of gene expression. It is the case of [57], where a miRNA associated with Huntington disease is detected or in [58], in which the same study is carried out with a miRNA linked with rheumatoid arthritis. The inset shows the enlargement of the calibration curve for the lower concentration range.…”

Section: Applicationsmentioning

confidence: 99%

Design and fabrication of novel optical fiber architectures for sensing applications

Imas¹

View full text Add to dashboard Cite

Optical fiber sensors have experienced an important progress in recent years with the employment of structures based on gratings, interferometers or electromagnetic resonances, among others; and the development of nanotechnology, that has enabled the deposition of coatings at the micro- and nanometric level on the fiber. These advances have allowed the manufacture of optical fiber sensors for measuring physical variables, chemical parameters or biosensing applications. This thesis contributes to the analysis and optimization, both theoretical and experimental, of different configurations and structures in optical fiber, applied to the development of sensors. Several structures are studied in this thesis, including Lossy Mode Resonances (LMRs) and optical fiber gratings: FBGs (fiber Bragg gratings), LPGs (long period fiber gratings) and TFBGs (tilted fiber Bragg gratings). The main research lines that are presented in this thesis are the fabrication of multisensing devices based on LMRs and the enhancement of the mode transition in optical fiber gratings: LPGs in double clad fibers and TFBGs. The common element between both research lines is the employment of thin films of high refractive index materials: tin oxide (SnO2), indium tin oxide (ITO) and titanium dioxide (TiO2). The results shown in this thesis reveal the potential of combining several structures and/or phenomena in optical fibers to improve the performance of optical fiber sensors.

show abstract

Short single strand DNA detection by means of Lossy Mode Resonance based fiber-optic sensor

Cited by 3 publications

References 9 publications

Advances in sensors using lossy mode resonances

Advances in sensors using lossy mode resonances

Optical Biosensors for the Detection of Rheumatoid Arthritis (RA) Biomarkers: A Comprehensive Review

Design and fabrication of novel optical fiber architectures for sensing applications

Contact Info

Product

Resources

About