Sesquiterpene glucosylation mediated by glucosyltransferase UGT91Q2 is involved in the modulation of cold stress tolerance in tea plants

Abstract

Summary Plants produce and emit terpenes, including sesquiterpenes, during growth and development, which serve different functions in plants. The sesquiterpene nerolidol has health‐promoting properties and adds a floral scent to plants. However, the glycosylation mechanism of nerolidol and its biological roles in plants remained unknown. Sesquiterpene UDP‐glucosyltransferases were selected by using metabolites‐genes correlation analysis, and its roles in response to cold stress were studied. We discovered the first plant UGT (UGT91Q2) in tea plant, whose expression is strongly induced by cold stress and which specifically catalyzes the glucosylation of nerolidol. The accumulation of nerolidol glucoside was consistent with the expression level of UGT91Q2 in response to cold stress, as well as in different tea cultivars. The reactive oxygen species (ROS) scavenging capacity of nerolidol glucoside was significantly higher than that of free nerolidol. Down‐regulation of UGT91Q2 resulted in reduced accumulation of nerolidol glucoside, ROS scavenging capacity and tea plant cold tolerance. Tea plants absorbed airborne nerolidol and converted it to its glucoside, subsequently enhancing tea plant cold stress tolerance. Nerolidol plays a role in response to cold stress as well as in triggering plant–plant communication in response to cold stress. Our findings reveal previously unidentified roles of volatiles in response to abiotic stress in plants.

Scenarios of Genes-to-Terpenoids Network Led to the Identification of a Novel α/β-Farnesene/β-Ocimene Synthase in Camellia sinensis

“…Then, an array of TPS catalyzes FPP and GPP to generate kinds of terpenoids. Taken all together, 29 genes were annotated as TPSs, including CIN/LIC, MYS/OCS, LIS/NES, NUDX, FAS, CPS/HUS, SQS and BAS, and among them, nerolidol synthase (CsNES) [17], β-ocimene synthase (CsOCS) [18] and linalool synthase (CsLIS) [19] were recently functionally characterized in C. sinensis plants.…”

“…The in planta functions of TPS2 were also studied in C. sinensis plants by transient suppression of the expression of TPS2 using TPS2 specific antisense oligonucleotides (AsODNs), according to Liu et al [18]. A significant transcript level reduction in TPS2 was detected after 24 h compared to control plants (CK; Figure 6b).…”

“…The functional assay of TPS2 in tea plants was carried out by gene suppression of TPS2 in C. sinensis, according to Liu et al [18]. Candidate sequences of the antisense oligonucleotides (AsODN-TPS2: TTGTTGATCTGCTAGCATTC) with complementarity to the segment of TPS2 were selected using Soligo software (http://sfold.wadsworth.org/cgi-bin/index.pl) with TPS2 sequences as inputs.…”

“…Terpene synthases (TPSs) in plants are extensively studied and have been divided into seven subfamilies. The biosynthesis of terpenoids in Camellia sinensis is predicted based on the knowledge of the pathways elucidated in other plants, whereas the scenarios of genes to metabolites of terpenes biosynthesis pathway in tea plants remain uninvestigated and most of the TPSs in tea plants, until now, are unknown, except the recently characterized TPSs involved in the formation of (E)-nerolidol, linalool [17,18], ocimene [19] and α-farnesene [20].…”

UGT74AF3 enzymes specifically catalyze the glucosylation of 4-hydroxy-2,5-dimethylfuran-3(2H)-one, an important volatile compound in Camellia sinensis

“…The previously described procedure for gene suppression in tea leaves was modified 31 . Candidate sequences of antisense oligonucleotides (AsODN) containing complementarity to the segment of the target gene were selected by using Soligo software 32 .…”