Sequencing and identification of a cDNA done for tomato polygalacturonase

Grierson, Donald; Tucker, Gregory A.; Keen, Jeff N.; Ray, John A.; Bird, Colin R.; Schuch, Wolfgang

doi:10.1093/nar/14.21.8595

Cited by 175 publications

(90 citation statements)

References 13 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The calculated molecular mass of the deduced mature PGII is 35 kDa, which agrees well with experimental data [3]. An alignment of the sequences of the mature PGII and the mature tomato PG [15,16] indicates a low (27010) but significant homology and also confirms the presence and location of the intron in the pgaI1 gene (not shown). GAAGCTCGAGACAGCTGCACGTTCACCACCGCTGCCGCTGCTAAAGCGGGCAAGGCGAAATGCTCTACTATC 144 **********************R*****C*******t* Fig.…”

Section: Manipulation Of Dnasupporting

confidence: 85%

Molecular cloning, nucleotide sequence and expression of the gene encoding prepro‐polygalacturonasell of Aspergillus niger

1990

View full text Add to dashboard Cite

Polygalact~ron~eIlof ~spergjtZ~ niger was fragmented using CNBr and the NHr-terminal fragment and another fragment were partially sequenced. The poiygalacturonasell @gofI) gene was then isolated by using an oligonucleotide mixture based on the internal ammo acid sequence as a probe. The nucleotide sequence of thepgaI1 structural gene was determined. It was found that polygalacturonaseI1 is synthesized as a precursor having an NH,-terminal prepro-sequence of 27 amino acids. The cloned gene was used to construct polygalacturonaseI1 over-producing A. niger strains. PolygalacturonaseII was isolated from one such strain and was determined to be correctiy processed and to be fully active.

show abstract

Section: Manipulation Of Dnasupporting

confidence: 85%

Molecular cloning, nucleotide sequence and expression of the gene encoding prepro‐polygalacturonasell of Aspergillus niger

1990

View full text Add to dashboard Cite

show abstract

“…Subsequently, Pogson and Brady (1993a) prepared antibodies to the ft subunit and to PG1 but found these antibodies to have extensive cross-reaction with PG2, which necessitated preadsorption to PG2 before their use. We prepared antibodies to the ft subunit, but our antiserum did not appear to cross-react with PG2, which is consistent with the lack of homology between the ft subunit gene (Zheng et al, 1992) and PG2 (Grierson et al, 1986;Bennett and DellaPenna, 1987). Anti-0 subunit antibodies detected a protein in green fruit, consistent with the presence of a converter activity in this tissue (Tucker et al, 1981) and consistent with the presence of the mRNA for this protein at this stage in fruit development (Zheng et al, 1992).…”

Section: Tomato Fruit Converter Activity and Characterization Of The supporting

confidence: 71%

Tomato Fruit Polygalacturonase Isozyme 1 (Characterization of the [beta] Subunit and Its State of Assembly in Vivo)

Moore¹,

Bennett²

1994

Plant Physiol.

View full text Add to dashboard Cite

~Polygalacturonase isozyme 1 (PC1) is a heterodimer comprising a catalytic and noncatalytic or B subunit, whereas polygalacturonase isozyme 2 (PC2) comprises only the catalytic subunit. To assess the state of assembly of PCI in vivo, both subunits were purified to homogeneity and used to study assembly of the heterodimer.PC1 could be reconstituted in vitro from purified B subunit and purified PC2 under a wide range of salt and pH conditions, and PC1 reconstituted in vitro was indistinguishable from PC1 isolated from tomato (Lycopersicon esculentum) fruit. Specific antibodies indicated that the B subunit was present in fruit of all developmental stages, but absent in vegetative tissue. l h e state of assembly of PC1 in vivo was tested based on the differential thermal stability of PC1 and PC2 by heating segments of ripe fruit pericarp tissue. Temperatures well below those required to inactivate PC1 in vitro caused the loss of activity of both PC1 and PC2, suggesting that only heat-labile PC2 is present in vivo. In addition, when extracts of ripe fruit were rigorously maintained and analyzed at 4"C, PC1 was absent or barely detectable. These results are consistent with the hypothesis that PG1 can assemble spontaneously and i s essentially absent in intact tomato fruit but forms artifactually from PG2 and the B subunit during the extraction of tomato fruit tissue when low temperatures are not rigorously maintained.

show abstract

“…However, searching the SWISS-PROT database revealed that the Cryj II amino acid sequence shares a significant homology with polygalacturonases (PGs), especially that derived from tomato, Lycopersicon esculentum (40% identity, Fig. 2) [14,15], from Zea mays (34% identity) [16,17], and that from Oenothera organensis (34% identity) [18].…”

Section: Resultsmentioning

confidence: 99%

Molecular cloning of the second major allergen, Cry j II, from Japanese cedar pollen

et al. 1994

View full text Add to dashboard Cite

show abstract

Sequencing and identification of a cDNA done for tomato polygalacturonase

Cited by 175 publications

References 13 publications

Molecular cloning, nucleotide sequence and expression of the gene encoding prepro‐polygalacturonasell of Aspergillus niger

Molecular cloning, nucleotide sequence and expression of the gene encoding prepro‐polygalacturonasell of Aspergillus niger

Tomato Fruit Polygalacturonase Isozyme 1 (Characterization of the [beta] Subunit and Its State of Assembly in Vivo)

Molecular cloning of the second major allergen, Cry j II, from Japanese cedar pollen

Contact Info

Product

Resources

About