Sequence of picornavirus RNAs containing a radioiodinated 5'-linked peptide reveals a conserved 5' sequence.

Abstract

Virion RNA (vRNA) from poliovirus type 1 (PV1), poliovirus type 2 (PV2), and coxsackie virus Bi (Cox Bi) were treated with proteinase K to remove all but a small peptide of the covalently attached 5' genome-linked virion protein (VPg) The peptide on these RNA molecules was then treated with Bolton-Hunter 125I reagent, which iodinates primary amine groups, in order to obtain specific 5'-terminal radioactive labeling. Sequences of 125I-labeled vRNAs were determined by using a set of base-specific RNases and a partial alkaline hydrolysis "ladder." The first 20 positions of these RNAs show a remarkable conservation of sequence. The initial 10 nucleotides are identical in PV1, PV2, and Cox B1, with the sequence VPg-pU-U-A-A-A-A-C-A-G-C-. The next 10 nucleotide s ow a one-base difference between PV1 and PV2 and 50% homology between PV1 and Cox B1. This conserved 5' region may provide a recognition site for interaction between the viral mRNA and the host translation system. The translation of picornavirus mRNA within the infected host cell is unusual because these viral RNAs are not capped and methylated at the 5' terminus (1-4). In fact, the virion RNA (vRNA) of several picornaviruses containsa small genome-linked protein (VPg) attached covalently to the 5' terminus via a bond between a phosphate and a tyrosine residue (5-10). Polyribosome-associated vRNA of poliovirus type 1 (PV1) does not contain VPg but instead terminates with pUp (1-3). The presence of VPg on PV1 has been used to select a RNase Ti-resistant oligonucleotide and therefore to obtain the 5'-terminal sequence (VPg)-pU-U-A-A-A-A-C-A-G (6).We have specifically labeled the 5' terminus of vRNAs by iodination (using Bolton-Hunter 125I reagent*) of a proteinase K-resistant core of VPg attached to the RNA molecule (11) and have used these molecules to obtain sequence information. We report here a comparison of the 5'-terminal sequence of PV1 (Mahoney), poliovirus type 2 (PV2), and coxsackie virus Bi (Cox Bi). We find a remarkable conservation of sequence within the initial 20 nucleotides. Because picornavirus infection results in a specific inhibition of host protein synthesis and a preferential translation of viral proteins, this sequence suggests that a common 5' structure in the viral mRNA may be required for ribosomal recognition. MATERIALS AND METHODSGrowth of Cells and Viruses. HeLa S3 cells were grown in suspension culture as described (12). The growth and purification of PV1 in these-cells was by methods published elsewhere (13). PV2 and Cox Bi were obtained from J. Holland (University of California, San Diego). Virus was grown in HeLa cells as described for PV1. PV2 and Cox B1 were purified by lysing infected cells with 0.01 M NaCl/0.01 M Tris1HCI, pH 7.4, containing 1% Nonidet P-40 and pelleting virus from the cytoplasm in the absence of sodium dodecyl sulfate (NaDod-S04). Virus was purified by isopycnic banding in CsCl.Purification and Proteinase K Treatment of vRNA. Intact vRNA from each virus was obtained by acid/NaDodSO4 lysis (14) ...

The Complete Nucleotide Sequence of Coxsackievirus B4 and Its Comparison to Other Members of the Picornaviridae

“…The first 10 nucleotides are identical in all these viruses. This conservation of sequence may be important for interactions with proteins involved in the replication of the viral RNA (Lindberg et al, 1987;Hewlett & Florkiewicz, 1980;Toyoda et al, 1984 TAGAGA~TTCTA~TGA~TACTACCACGGCCCAC~G~TGC~AC~CCATTGCCAGATGCCAATGCACAA~A~T~TGTACTTTTGC~CCTCCAAG~[GCAAA 3410 3430 3450 3470 3490 3510 3530 3550 3570 3590 SEPGDC GG I LECEHGV I GOVTNGGEGVVGFAD Q T~TCCGAACCAGGAGATTGC~GTGGAATTCTCAGGTCCGAA~ACGG~GTCATCGGTCTTGTCACCAT~GGTGGTGAAGGCGTGGTTG~TTTCGCCGAT~T 3610 3630 3650 3670 3690 P2 Tracy et al (1985) and Lindberg et al (1987) for CB3, Stanway et al (1984b) for PV3 and Stanway et al (1984a) for HRV14.…”

Cloned Poliovirus Complementary DNA Is Infectious in Mammalian Cells

“…This requirement for the 5' end is not surprising, because it is known that at least the first ten bases are conserved among aH three poliovirus types and Coxsackie virus B1 (8,9). Although the AUG that initiates the poliovirus polyprotein appears to be located at nucleotide 743, there are also eight other AtJG codons in the preceding region (3).…”

Nucleic acid detection systems for enteroviruses

“…The EVs also have in common their fecal-oral route of transmission (from which the name enteroviruses evolved) and their appearance by electron microscopy. Early and very limited sequence comparisons confirmed genomic regions of great similarity among certain serotypes (43), as did heteroduplex mapping techniques using electron microscopy (30).…”