Selective inhibition of IL-6 trans-signaling by a miniaturized, optimized chimeric soluble gp130 inhibits T _H 17 cell expansion

Abstract

The cytokine IL-6 performs critical functions in various tissue types but is implicated in autoimmune disease. Therefore, precisely targeting the pathway by which IL-6 induces inflammatory immune cell activation could leave other signaling pathways and functions of IL-6 intact. Currently, such targeted molecules lack sufficient selectivity. Heise et al. developed a chimeric molecule that bound to and "trapped" a critical IL-6 trans-signaling protein complex and that was smaller, had greater selectivity for the IL-6 complex over a similar IL-11 complex, and more effectively inhibited the IL-6-induced inflammatory activation of cultured T cells. These findings may lead to improved therapeutics for patients with autoimmune disease.

Exclusive inhibition of IL-6 trans-signaling by soluble gp130FlyRFc

“…The Fly mutations (T102 Y /Q113 F /N114 L ) are located in the Ig-like D1 domain and increase the affinity towards binding site III of IL-6 of gp130 to increase the inhibitory capacity of sgp130Fc towards IL-6:sIL-6R complexes [23] . Just recently, we found a decreased affinity for Fly towards site III of IL-11 and thereby reduced inhibitory capacity of sgp130Fc towards IL-11:sIL-11R complexes [24] . Only IL-27 of the IL-6 family also interacts with the Ig-like D1 domain of gp130.…”

“…A cDNA for human IL-11 was synthesized (Biocat GmbH, Heidelberg Germany) and subcloned into pcDNA3.1 via standard PCR methods. For the generation of sgp130 R281Q Fc and sgp130 FLYR Fc site-directed mutagenesis using the following primers (sgp130R281Q rv (5́-3́):ctgcactgtgaagctggactgggtggaagcggtatcctc and sgp130R281Qfw (5́-3́): gaggataccgcttccacccagtccagcttcacagtgcag) was performed on expression plasmids encoding sgp130Fc or sgp130 FLY Fc templates [24] . HIL-11 was subcloned via HindIII and NotI in pcDNA3.1 vector (Invitrogen) containing N-terminal signal peptide and a C-terminal Twin-Strep-Tag, thereby generating pcDNA3.1-HIL-11-TS for secreted expression.…”

IL-6 in the Ecosystem of Head and Neck Cancer: Possible Therapeutic Perspectives

“…A plethora of potential anti-IL-6 therapeutics have been preclinically investigated; many available drugs could also be repurposed for application in cancer therapy (shortlisted in Supplementary Table S1; [25,146,154,155,165,169,170,173,174,). Available data indicate potential benefits for certain types of solid malignancies, which could also apply to HNSCC patients.…”

“…However, the soluble gp130 form is also known. The mechanism leading to the production of soluble gp130 has been discussed; whether it is formed via alternative splicing, or as suggested more recently, is a product of BACE cleavage [173]. In any case, the soluble form of gp130 binds the IL-6/IL-6R complex, but does not transduce the signal to the cell anymore.…”

“…Of note, trans-signaling inhibitor olamkicept was well tolerated in the treatment of inflammatory bowel disease, and this drug was administered without signs of immunosuppression in patients [174]. Gp130 is a large molecule, but it could be manufactured in a miniaturized form, which could be a pharmacologically important modification [173].…”