Selection of Suitable Reference Genes Based on Transcriptomic Data in Ginkgo biloba under Different Experimental Conditions

Zhou, Tingting; Yang, Xiaoming; Fu, Fangfang; Wang, Guibin; Cao, Fuliang

doi:10.3390/f11111217

Cited by 11 publications

(3 citation statements)

References 72 publications

(86 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“… 41 Thus, it is speculated that GbPAL4 and GbPAL10 may play a relatively significant role in secondary metabolic activity during flowering. 42 …”

Section: Discussionmentioning

confidence: 99%

Expression profiling of the phenylalanine ammonia-lyase ( PAL ) gene family in ginkgo biloba L.

Gao,

Hu,

et al. 2023

Plant Signaling & Behavior

View full text Add to dashboard Cite

The PAL gene family plays an important role in plant growth, development, and response to abiotic stresses and has been identified in a variety of plants. However, a systematic characterization is still lacking in Ginkgo biloba . Using a bioinformatics approach, 11 GbPAL members of the PAL gene family identified in ginkgo were identified in this study. The protein structure and physicochemical properties indicated that the GbPAL genes were highly similar. Based on their exon-intron structures, they can be classified into three groups. A total of 62 cis-elements for hormone, light, and abiotic stress responses were identified in the promoters of GbPAL genes, indicating that PAL is a multifunctional gene family. GbPAL genes were specifically expressed in different tissues and ploidy of ginkgo. These results provide a theoretical basis for further studies on the functional expression of the GbPAL genes.

show abstract

“… 41 Thus, it is speculated that GbPAL4 and GbPAL10 may play a relatively significant role in secondary metabolic activity during flowering. 42 …”

Section: Discussionmentioning

confidence: 99%

Expression profiling of the phenylalanine ammonia-lyase ( PAL ) gene family in ginkgo biloba L.

Gao,

Hu,

et al. 2023

Plant Signaling & Behavior

View full text Add to dashboard Cite

show abstract

“…The 2 −∆∆Ct technique was used to calculate relative expression levels [ 58 ]. GbCHS (F: CAAGCGCATGTGCGACAAGT, R: CACCTCCACCACCACCATGT) was used as an endogenous control [ 59 ]. Each reaction in every experiment was repeated three times.…”

Section: Methodsmentioning

confidence: 99%

High-Depth Transcriptome Reveals Differences in Natural Haploid Ginkgo biloba L. Due to the Effect of Reduced Gene Dosage

Šmarda

Liu

et al. 2022

IJMS

View full text Add to dashboard Cite

As a representative of gymnosperms, the discovery of natural haploids of Ginkgo biloba L. has opened a new door for its research. Haploid germplasm has always been a research material of interest to researchers because of its special characteristics. However, we do not yet know the special features and mechanisms of haploid ginkgo following this significant discovery. In this study, we conducted a homogenous garden experiment on haploid and diploid ginkgo to explore the differences in growth, physiology and biochemistry between the two. Additionally, a high-depth transcriptome database of both was established to reveal their transcriptional differences. The results showed that haploid ginkgo exhibited weaker growth potential, lower photosynthesis and flavonoid accumulation capacity. Although the up-regulated expression of DEGs in haploid ginkgo reached 46.7% of the total DEGs in the whole transcriptome data, the gene sets of photosynthesis metabolic, glycolysis/gluconeogenesis and flavonoid biosynthesis pathways, which were significantly related to these differences, were found to show a significant down-regulated expression trend by gene set enrichment analysis (GSEA). We further found that the major metabolic pathways in the haploid ginkgo transcriptional database were down-regulated in expression compared to the diploid. This study reveals for the first time the phenotypic, growth and physiological differences in haploid ginkgos, and demonstrates their transcriptional patterns based on high-depth transcriptomic data, laying the foundation for subsequent in-depth studies of haploid ginkgos.

show abstract

“…In the PEG set of A. melanoxylon, heat stress of bermudagrass [52], and various tissue sets of Isatis indigotica fortune [53], TIP41 was the unstable gene. Ubiquitin, a small regulatory protein found in diverse eukaryotic tissues, is widely employed as a reference gene for RT-qPCR due to its high expression stability in plants [54,55]. In previous work, UBI3 exhibited the highest stability under hormone stimuli treatments in Scutellaria baicalensis [56].…”

Section: Rt-qpcr Is a Widely Used Technology In Molecular Biology For...mentioning

confidence: 99%

Selection of Reference Genes for Gene Expression Analysis in Acacia melanoxylon under Different Conditions

Chen,

Bai,

et al. 2023

Forests

View full text Add to dashboard Cite

The research of functional genes in Acacia melanoxylon, a precious and fast-growing timber species with wide adaptability, has been greatly limited due to the absence of reliable and suitable reference genes. To fill this gap, five different algorithms (comparative ΔCt, NormFinder, geNorm, BestKeeper, and RankAggreg) were employed to assess the expression stability of ten candidate genes under nine different experimental sets and their three combined groups. The results showed that PP2a and RPL4 maintained stable expression in all 144 samples and a group of different tissues or organs. PAT10 and TIP41 were the best-performing genes in different clonal varieties, pinnate compound leaves at different growth states, salt, and indole acetic acid sets. PP2a and PAT10 were the top two choices for gibberellin and abiotic stress groups. PP2a and UBI11 exhibited stable expression in drought treatment. UBI3 combined with OTUD6B, RPL4, or PP2a were identified as the optimal reference genes in the heat, ethephon, or exogenous hormone groups, respectively. The reliability of the selected reference genes was further confirmed by evaluating the expression patterns of AmWRKY6 and AmWRKY33 genes. This study provides the first comprehensive evaluation of reference gene stability in A. melanoxylon and promotes future research on the gene expression analysis of the species.

show abstract

Selection of Suitable Reference Genes Based on Transcriptomic Data in Ginkgo biloba under Different Experimental Conditions

Cited by 11 publications

References 72 publications

Expression profiling of the phenylalanine ammonia-lyase ( PAL ) gene family in ginkgo biloba L.

Expression profiling of the phenylalanine ammonia-lyase ( PAL ) gene family in ginkgo biloba L.

High-Depth Transcriptome Reveals Differences in Natural Haploid Ginkgo biloba L. Due to the Effect of Reduced Gene Dosage

Selection of Reference Genes for Gene Expression Analysis in Acacia melanoxylon under Different Conditions

Contact Info

Product

Resources

About