Secondary Placental Defects in Cxadr Mutant Mice

Outhwaite, J.E.; Patel, Jatin; Simmons, David G.

doi:10.3389/fphys.2019.00622

Cited by 8 publications

(8 citation statements)

References 72 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Severe conceptus skewing at E10.5 was also associated with embryonic developmental delay and heart malformations. Others have proposed the placentaheart axis whereby that primary placental phenotype can result in secondary cardiovascular abnormalities (Barak et al, 1999;Hemberger and Cross, 2001;Perez-Garcia et al, 2018), and vice versa (Outhwaite et al, 2019). Whether this phenomenon occurs in skewed conceptuses is unclear and requires more careful consideration of heart development in the Mtrr gt model from earlier stages and investigation by conditional mutation or tetraploid aggregation experiments that isolate the consequences of heart-only or placenta-only knockdown of Mtrr.…”

Section: Discussionmentioning

confidence: 99%

“…In situ hybridisation probes were generated with gene-specific primer sets (Supplementary Table S1) that contained T7 RNA polymerase promoter sequence (TAATACGACTCACTATAG GG) attached to each reverse primer and T3 RNA polymerase promoter sequence (AATTAACCCTCACTAAAGGG) attached to each forward primer (Outhwaite et al, 2019). Probe synthesis of digoxigenin (DIG)-labelled anti-sense and sense probes was performed via PCR using DIG RNA labelling Mix (Cat.…”

Section: In Situ Hybridizationmentioning

confidence: 99%

See 1 more Smart Citation

Disruption of Folate Metabolism Causes Poor Alignment and Spacing of Mouse Conceptuses for Multiple Generations

Wilkinson

Menelaou

Rakoczy

et al. 2021

Front. Cell Dev. Biol.

View full text Add to dashboard Cite

Abnormal uptake or metabolism of folate increases risk of human pregnancy complications, though the mechanism is unclear. Here, we explore how defective folate metabolism influences early development by analysing mice with the hypomorphic Mtrrgt mutation. MTRR is necessary for methyl group utilisation from folate metabolism, and the Mtrrgt allele disrupts this process. We show that the spectrum of phenotypes previously observed in Mtrrgt/gt conceptuses at embryonic day (E) 10.5 is apparent from E8.5 including developmental delay, congenital malformations, and placental phenotypes. Notably, we report misalignment of some Mtrrgt conceptuses within their implantation sites from E6.5. The degree of misorientation occurs across a continuum, with the most severe form visible upon gross dissection. Additionally, some Mtrrgt/gt conceptuses display twinning. Therefore, we implicate folate metabolism in blastocyst orientation and spacing at implantation. Skewed growth likely influences embryo development since developmental delay and heart malformations (but not defects in neural tube closure or trophoblast differentiation) associate with severe misalignment of Mtrrgt/gt conceptuses. Typically, the uterus is thought to guide conceptus orientation. To investigate a uterine effect of the Mtrrgt allele, we manipulate the maternal Mtrr genotype. Misaligned conceptuses were observed in litters of Mtrr+/+, Mtrr+/gt, and Mtrrgt/gt mothers. While progesterone and/or BMP2 signalling might be disrupted, normal decidual morphology, patterning, and blood perfusion are evident at E6.5 regardless of conceptus orientation. These observations argue against a post-implantation uterine defect as a cause of conceptus misalignment. Since litters of Mtrr+/+ mothers display conceptus misalignment, a grandparental effect is explored. Multigenerational phenotype inheritance is characteristic of the Mtrrgt model, though the mechanism remains unclear. Genetic pedigree analysis reveals that severe conceptus skewing associates with the Mtrr genotype of either maternal grandparent. Moreover, the presence of conceptus skewing after embryo transfer into a control uterus indicates that misalignment is independent of the peri- and/or post-implantation uterus and instead is likely attributed to an embryonic mechanism that is epigenetically inherited. Overall, our data indicates that abnormal folate metabolism influences conceptus orientation over multiple generations with implications for subsequent development. This study casts light on the complex role of folate metabolism during development beyond a direct maternal effect.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: In Situ Hybridizationmentioning

confidence: 99%

Disruption of Folate Metabolism Causes Poor Alignment and Spacing of Mouse Conceptuses for Multiple Generations

Wilkinson

Menelaou

Rakoczy

et al. 2021

Front. Cell Dev. Biol.

View full text Add to dashboard Cite

show abstract

“…In addition, administration of excess glucocorticoids has also shown reduced placental vascularisation that coincides with delayed heart development (Wyroll, et al 2016). Many genetic knockout models show heart and placental defects such Cxadr (Outhwaite, et al 2019), Fltr2 (Tai-Nagara, et al 2017), Hoxa13 (Shaut, et al 2008), p38a MAPK (Adams, et al 2000), among others (reviewed by Maslen, 2018, Camm, et al 2018.…”

Section: Discussionmentioning

confidence: 99%

Maternal iron deficiency impacts the placental arterial network

Kalisch-Smith

Morris

et al. 2021

Preprint

Self Cite

View full text Add to dashboard Cite

Placental vascular gene networks in mammals have been largely unexplored due to a lack of well validated molecular markers to identify them. This is required to study how they form in development, and how they are impacted by embryonic or maternal defects, which in-turn adversely affects the forming heart and vasculature. Such defects are known to be a consequence of maternal iron deficiency (ID), the most common nutrient deficiency world-wide. Here we employed marker analysis to characterise the arterial/arteriole and venous/venule endothelial cells (ECs) during normal placental development, and in the context of maternal ID. We reveal for the first time that placental ECs are unique compared with their embryonic counterparts. In the developing embryo, arterial ECs express Neuropilin1 (Nrp1), Delta-like ligand 4 (Dll4) and Notch1, while developing venous ECs express Neuropilin2 (Nrp2), Apj (Aplnr) and Ephrinb4 (Ephb4). However, in the E15.5 placenta, Nrp1 and Notch1 were restricted to arteries, but not continuing arteriole ECs. The arterial tree exclusively expressed Dll4. Nrp2 showed pan-EC expression at E15.5, while Ephb4 was not present at this stage. However, we found the placental venous vascular tree could be distinguished from the arterial tree by high versus low Endomucin (EMCN) and Apj (Aplnr) expression respectively. Using EMCN, we reveal that the placental arterial, but not venous, vascular tree is adversely impacted by maternal ID, with reduced area, total length and number of junctions of all vessels without affecting the EMCN high vessels. Defects to the embryonic cardiovascular system can therefore have a significant impact on blood flow delivery and expansion of the placental arterial tree.

show abstract

“…Two subsets of ECs have been identified at E10.5. Candidate markers Vegfa and Vegfc have been proposed as arterial and venous markers, respectively ( Outhwaite et al, 2019 ). The Apelin receptor Aplnr (Apj) may also be expressed solely in veins ( Outhwaite et al, 2019 ).…”

Section: Introductionmentioning

confidence: 99%

“…Candidate markers Vegfa and Vegfc have been proposed as arterial and venous markers, respectively ( Outhwaite et al, 2019 ). The Apelin receptor Aplnr (Apj) may also be expressed solely in veins ( Outhwaite et al, 2019 ). In the embryo, these are well-defined markers of arterial and venous specification and so may be acting in a similar manner in the placenta.…”

Section: Introductionmentioning

confidence: 99%

Analysis of Placental Arteriovenous Formation Reveals New Insights Into Embryos With Congenital Heart Defects

et al. 2022

Self Cite

View full text Add to dashboard Cite

The placental vasculature provides the developing embryo with a circulation to deliver nutrients and dispose of waste products. However, in the mouse, the vascular components of the chorio-allantoic placenta have been largely unexplored due to a lack of well-validated molecular markers. This is required to study how these blood vessels form in development and how they are impacted by embryonic or maternal defects. Here, we employed marker analysis to characterize the arterial/arteriole and venous/venule endothelial cells (ECs) during normal mouse placental development. We reveal that placental ECs are potentially unique compared with their embryonic counterparts. We assessed embryonic markers of arterial ECs, venous ECs, and their capillary counterparts—arteriole and venule ECs. Major findings were that the arterial tree exclusively expressed Dll4, and venous vascular tree could be distinguished from the arterial tree by Endomucin (EMCN) expression levels. The relationship between the placenta and developing heart is particularly interesting. These two organs form at the same stages of embryogenesis and are well known to affect each other’s growth trajectories. However, although there are many mouse models of heart defects, these are not routinely assessed for placental defects. Using these new placental vascular markers, we reveal that mouse embryos from one model of heart defects, caused by maternal iron deficiency, also have defects in the formation of the placental arterial, but not the venous, vascular tree. Defects to the embryonic cardiovascular system can therefore have a significant impact on blood flow delivery and expansion of the placental arterial tree.

show abstract

Secondary Placental Defects in Cxadr Mutant Mice

Cited by 8 publications

References 72 publications

Disruption of Folate Metabolism Causes Poor Alignment and Spacing of Mouse Conceptuses for Multiple Generations

Disruption of Folate Metabolism Causes Poor Alignment and Spacing of Mouse Conceptuses for Multiple Generations

Maternal iron deficiency impacts the placental arterial network

Analysis of Placental Arteriovenous Formation Reveals New Insights Into Embryos With Congenital Heart Defects

Contact Info

Product

Resources

About