Searching for a Cell-Based Therapeutic Tool for Haemophilia A within the Embryonic/Foetal Liver and the Aorta-Gonads-Mesonephros Region

Abstract

The development of new strategies based on cell therapy approaches to correct haemophilia A (HA) requires further insights into new cell populations capable of producing coagulation factor VIII (FVIII) and presenting stable engraftment potential. The major producers of FVIII in the adult are liver sinusoidal endothelial cells (LSECs) and in a lesser degree bone marrow-derived cells, both of which have been shown to ameliorate the bleeding phenotype in adult HA mice after transplantation. We have previously shown that cells from the foetal liver (FL) and the aorta-gonads-mesonephros (AGM) haematopoietic locations possess higher LSEC engraftment potential in newborn mice compared with adult-derived LSECs, constituting likely therapeutic targets for the treatment of HA in neonates. However, less is known about the production of FVIII in embryonic locations. Quantitative polymerase chain reaction and Western blot analysis were performed to assess the relative level of FVIII production in different embryonic tissues and at various developmental stages, identifying the FL and AGM region from day 12 (E12) as prominent sources of FVIII. Furthermore, FL-derived VE-cadCD45Lyve1 endothelial/endothelial progenitor cells, presenting vascular engraftment potential, produced high levels of ribonucleic acid compared with CD45 blood progenitors or Dlk1 hepatoblasts. In addition, we show that the E11 AGM explant cultures expanded cells with LSEC repopulation activity, instrumental to further understand signals for in vitro generation of LSECs. Taking into account the capacity for FVIII expression, culture expansion and newborn engraftment potential, these results support the use of cells with foetal characteristics for correction of FVIII deficiency in young individuals.

The Vascular Endothelium and Coagulation: Homeostasis, Disease, and Treatment, with a Focus on the Von Willebrand Factor and Factors VIII and V

“…Our group has described the production of F8 gene mRNA in different embryonic/fetal tissues, identifying a predominant window of expression at day 12 of embryonic development (E12) in the aorta/gonad/mesonephros (AGM) region and the liver. Moreover, an analysis of isolated cells from the fetal liver showed that VE-cad + CD45 - endothelial cells resulted in higher levels of F8 gene expression compared to hematopoietic (CD45 + ) cells or hepatocytes (Dlk1 + ) [ 186 ], supporting the notion that FVIII is produced in embryonic endothelial cells in similar quantities as in adults. Recent studies using genetically engineered mice in which the enhanced green fluorescent protein (EGFP) rather than the F8 gene transcript was expressed under the regulation of the F8 locus showed that from developmental stage E12, liver sinusoidal epithelial cells (LSECs) exhibit varying amounts of EGFP, FVIII-producing LSECs being visible from the early stages of development.…”

Therapeutic potential of fetal liver cell transplantation in hemophilia A mice

“…We previously demonstrated that FL cells engrafted and repopulated the hemato/vascular compartment of wild type (wt) newborn recipient mice 24 , and additionally characterized in the FL a unique cell population capable of a stable multiorgan endothelial reconstitution, mostly composed of endothelial committed cells 23 . More recently, we also reported that FVIII mRNA progressively increases in the FL and in other different embryonic locations from day 9 to day 12 of gestation (E9-12), in parallel to the expansion of the vascular network 38 .…”

“…For quantitative real-time polymerase chain reaction (qRTPCR), total RNA was extracted and cDNA was obtained as previously described. 38 Results were analyzed using the relative expression method (2 -ΔCt ). The PCR primers designed for mouse f8 and GAPDH are: mouse f8 E16 F 5’ TGGCACCCACAGAAGATGAG 3’ and mouse f8 E17 R 5’ GGCAAATCAGAAGGGGTCCA 3’ (amplicon size 108 bp); GAPDH F 5’ CATGGCCTTCCGTGTTCCTA 3’ and GAPDH R 5’ GCGGCACGTCAGATCCA 3’ (amplicon size 55 bp).…”

“…For quantitative real-time polymerase chain reaction (qRTPCR), total RNA was extracted and cDNA obtained as previously described 38 . Results were analysed using the relative expression method (2 -ΔCt ).…”

Endothelial cells derived from patients’ induced pluripotent stem cells for sustained factor VIII delivery and the treatment of hemophilia A

“…It has been shown that fetal liver endothelial progenitors have much robust engraftment potential in newborn animals compared with adult LSEC. 40,41 We found that, when transplanted at the neonatal stage, the ECs derived from two different HA-iPSC lines were retained in mice for at least 16 weeks (Figure 3), suggesting consistent engraftment of the ECs. When the ECs derived from the same HA-iPSC line were tested in both neonatal and adult mice, the ECs were retained in all tested mice but slightly more cells were retained when transplanted at the neonatal stage (Figure 3).…”