Search for methylation-sensitive amplification polymorphisms in mutant figs

Abstract

ABSTRACT. Fig (Ficus carica) breeding programs that use conventional approaches to develop new cultivars are rare, owing to limited genetic variability and the difficulty in obtaining plants via gamete fusion. Cytosine methylation in plants leads to gene repression, thereby affecting transcription without changing the DNA sequence. Previous studies using random amplification of polymorphic DNA and amplified fragment length polymorphism markers revealed no polymorphisms among select fig mutants that originated from gammairradiated buds. Therefore, we conducted methylation-sensitive amplified polymorphism analysis to verify the existence of variability due to epigenetic DNA methylation among these mutant selections compared to the main cultivar 'Roxo-de-Valinhos'. Samples of genomic DNA were double-digested with either HpaII (methylation sensitive) or MspI (methylation insensitive) and with EcoRI. Fourteen primer combinations were tested, and on an average, non-methylated CCGG, symmetrically methylated CmCGG, and hemimethylated hmCCGG sites accounted for 87.9, 10.1, and 2.0%, respectively. MSAP analysis was effective in detecting differentially methylated sites in the genomic DNA of fig mutants, and methylation may be responsible for the phenotypic variation between treatments. Further analyses such as polymorphic DNA sequencing are necessary to validate these differences, standardize the regions of methylation, and analyze reads using bioinformatic tools.

Detection of differentially methylated regions of irradiated fig tree selections

“…For this Contig, a hemimethylation band was observed for treatment 3 when compared to the control (Rodrigues et al, 2013). As regards the characteristics that are unique and diverge from the other treatments, treatment 3 presented a low Brix ratio and a long peduncle, making harvesting easier and increasing fruit shelf life, the latter being considered an essential condition for export purposes.…”

“…Fourteen primer combinations were tested, and, on average, non-methylated CCGG sites (bands common to both digests), CmCGG symmetrical methylation (bands present in MspI digestions, but not in HpaII), and hemimethylated hmCCGG sites (bands present in HpaII, but not in MspI digestions), accounted, respectively, for 88 %, 10 %, and 2 % of the total number of 553 amplification products, of which six showed polymorphism (Rodrigues et al, 2013).…”

“…Contig 1 was obtained as a result of sequencing the first differentially methylated region, excised in the polyacrylamide gel applying the MSAP technique previously used by Rodrigues et al (2013), when, for this particular methylated region, treatment 4 presented one demethylated region when compared to the control. It is important to mention that treatment 4 has characteristics that are considered important in agriculture -a high Brix ratio and big fruit with a small closed ostiole, which prevents the incidence of plague and avoids fruit depreciation as they are less likely to have cracks.…”

“…The local alignment of Contigs 4 and 6 with the NCBI database, obtained from the fourth and sixth differentially methylated regions through the MSAP technique by Rodrigues et al (2013), produced a significant alignment with the coding region for S-receptor lecithin, similar to the G-type lectin S-receptor-like serine/ threonine-protein kinase from several plant species, such as date palm, banana tree, beetroot and mume, with respective access numbers in the NCBI database and E-value numbers as follows: XM_008777554.1 (1e-10), XM_009384383.1 (5e-09), XM_010667916.1 (1e-11 ) and XM_008248083.1 (5e-04), as can be seen in Figures 5 and 6.…”

“…After visualizing the methylation pattern in fig tree selections (Rodrigues et al, 2013), the bands of each polymorphic fragment for methylation that were of interest were cut from the polyacrylamide gel using a sterile scalpel blade and were transferred to 0. 1 BS1 TAGGTTGTGTTAAGTATGTT TATATCAATTAAAAAACTAC 2 BS2 GTTTTTTTATTTTTTTAGAGTATT TTCACAACTAAAATAAAAACTA 3 BS3 ATGAGTTTTGTTTTTTTTAGAGGTA TAACTACGTACCAATTCAC 4 BS4 ATGAGTTTTGTTTTTTTA TACGTACCAATTCAATC 5 BS5 TATGTTTAGAATTTAGAT ATATCAAAATTCAAAAAAAA 6 BS6 ATGAGTTTTGTTTTTTAGATGAAGG TAACTAATACCAATTCACC conical micro tubes.…”