Screening of recombinant proteins as antigens in indirect ELISA for diagnosis of bovine tuberculosis

Abstract

Bovine tuberculosis is an important infectious disease caused by Mycobacterium bovis, which is responsible for considerable economic losses. This disease constitutes a serious public health problem. Control programs in most countries, including Brazil, are based on the identification and slaughter of infected animals, as defined by the skin tuberculin test, which has its constraints. In the present study, the recombinant proteins CFP-10, ESAT-6, Mb0143, MPB83, PE5, PE13, TB10.4, TB15.3 and a chimera of ESAT-6/MPB70/MPB83 (fusion protein) were tested as ELISA antigens for the diagnosis of bovine tuberculosis. The proteins were produced in Escherichia coli, purified and tested in ELISAs with sera from 126 cattle having tested negative in the comparative intradermal tuberculin test (CITT) and 107 sera from cattle having tested positive in the CITT. Also, 236 sera from two BTB-free beef cattle herds were tested. Among the proteins tested, only the ESAT-6/MPB70/MPB83 chimera demonstrated satisfactory agreement with the CITT (kappa index: 0.688), reflecting in 83.2% sensitivity and 86.5% specificity. The ELISA absorbances of the cattle sera from BTB-free herds showed similar levels to those of CITT positive cattle, probably as the result of successive skin tuberculinizations to define the BTB-free status of the herds. However, the ELISA with the ESAT-6/MPB70/MPB83 chimera was useful to discriminate BTB positive and negative cattle in herds prior to the tuberculin skin test.

Comparison of recombinant MPB70 and SahH and a native 20-kDa protein for the detection of bovine tuberculosis by ELISA

“…and 75.5-98.0%, respectively [12,22,25,26]. In this study, rM70S showed higher or equivalent sensitivity and specificity than those in previous studies.…”

Teste intradérmico com proteínas recombinantes de Mycobacterium bovis como antígenos em Cavia porcellus

“…Os genes pe5, pe13 e esat-6 foram amplificados por reação em cadeia da polimerase (PCR) a partir de DNA de M. bovis cepa AN5, utilizando oligonucleotídeos iniciadores específicos desenhados e amplificados de acordo com Souza et al (2012). O gene esx-1 foi amplificado com os primers (forward: 5' TATCAATTCGGGGACGTCGACGCTCACG 3' e reverse: 5' GGCGCTGTCGGTTTGTGCCATGTTGTTG 3') desenhados utilizando o programa PrimerSelect (DNASTAR).…”

Evaluation of the use of recombinant proteins of Mycobacterium bovis as antigens in intradermal tests for diagnosis of bovine tuberculosis

“…All recombinant proteins used in this study were previously evaluated in ELISA as described by Souza et al (2012) and were recognised by antibodies (IgG) of cattle naturally infected with M. bovis.…”

“…The animals came from a herd with no clinical or pathological history of tuberculosis during the last 3 years, as evidenced by inspection at slaughter. In addition, all the animals used were negative in ELISA based on MPB70 and P27 recombinant antigens, according to Farias et al (2012). Twenty-four animals were sensitised by subcutaneous injection of 10 mg of inactivated heat (96-105 °C for 30 min) M. bovis AN5 strain, which was supplied by the LANAGRO/ Brazilian Ministry of Agriculture (Pedro Leopoldo, Brazil) to simulate the immunological response observed in M. bovis infected animals.…”

“…Primer sets were used to amplify the genes mb0143 (Rv0138), pe5 (Rv0285), pe13 (Rv1195) and tb10.4 (Rv0288) as described by Souza et al (2012). The primer set for the esxI (Rv1037c) gene (forward: 5' TATCAATTCGGGGACGTCGACGCTCACG 3' and reverse: 5' GGCGCTGTCGGTTTGTGCCATGTTGTTG 3') were designed using the PrimerSelect program (DNAStar).…”