Screening efficient siRNAs in vitro as the candidate genes for chicken anti-avian influenza virus H5N1 breeding

Abstract

The frequent disease outbreaks caused by avian influenza virus (AIV) not only affect the poultry industry but also pose a threat to human safety. To address the problem, RNA interference (RNAi) has recently been widely used as a potential antiviral approach. Transgenesis, in combination with RNAi to spe cifically inhibit AIV gene expression, has been proposed to make chickens resistant to avian influenza. For the transgenic breeding, screening the efficient siRNAs in vitro as the candidate genes is one of the most important tasks. Here, we combined an online search tool and a series of bioinformatics programs with a set of rules for designing the siRNAs targeting different mRNA regions of AIV H5N1 subtype. By this method we chose five rational siRNAs, constructed five U6 promoter driven shRNA expression plasmids contained the siRNA genes, and used these to produce stably transfected Madin Darby canine kidney (MDCK) cells. Data from virus titration, IFA, PUI stained flow cytometry, real time quantitative RT PCR and DAS ELISA analyses showed that all five stably transfected cell lines were effectively resistant to viral replication when exposed to 100 CCID 50 of AIV, and we finally chose the most effective plasmids (pSi 604i and pSi 1597i) as the candidates for making the transgenic chickens. These findings provide baseline information for breeding transgenic chickens resistant to AIV in combination with RNAi.

Genetics of Disease Resistance in Chicken

“…Finally transgenic chicken were developed from the plasmids (pSi604i and pSi 1597i). These findings provide baseline information for breeding transgenic chickens resistant to AIV in combination with RNAi [34].…”

Combination of specific single chain antibody variable fragment and siRNA has a synergistic inhibitory effect on the propagation of avian influenza virus H5N1 in chicken cells

“…From the above results, scFv1 was selected to be co-expressed with siRNA NP604 targeting the NP of FJ13 [ 15 ], and DF-1 cells were stably transfected with the shRNA-expression plasmid psiSTRIKE-NP604 (hereafter referred to as NP604 cells). Expression of GFP in the NP604 cells was observed by fluorescent microscopy 48 h following transient transfection with pIRES2-scFv1 (Figure 4 A).…”

“…Chicken DF-1 cells were stably transfected with the shRNA_expression plasmid psiSTRIKE-NP604 (Target sequence: AATGATCGGAATTTCTGGAGA) [ 15 ], using Lipofectamine™ 2000 reagent (Invitrogen). The transfected cells were selected with 800 μg/ml G418 (Merck) for 3 weeks with medium changed every 48 h. Individual colonies were picked and amplified in the same medium with 400 μg/ml G418.…”

“…Mouse anti-c-Myc Epitope tag mAb (MBL) diluted 1:1000 was the secondary antibody, and goat-anti-mouse IgG HRP (1:2000) (MBL) the third. The method details have been given previously [ 15 ].…”

RNA Secondary Structure Motifs of the Influenza A Virus as Targets for siRNA-Mediated RNA Interference

“…Region 649-667 nt, which is separated from the siRNA 613 target site by 17 nt, was targeted previously by NP604 (siRNA generated in cells from the plasmid construct), causing inhibition of strain A/duck/Fujian/13/2002 (H5N1) proliferation. 51 Although the experiments were conducted on different strains and the inhibitory effects were monitored by different methods, it is clear that the targeted structural domain is functionally important and prone to siRNA-mediated inhibition of influenza replication.…”