SCAMP5, NBEA and AMISYN: three candidate genes for autism involved in secretion of large dense-core vesicles

Abstract

Autism is a neurodevelopmental disorder characterized by impaired social reciprocity, impaired communication and stereotypical behaviors. Despite strong evidence for a genetic basis, few susceptibility genes have been identified. Here, we describe the positional cloning of SCAMP5, CLIC4 and PPCDC as candidate genes for autism, starting from a person with idiopathic, sporadic autism carrying a de novo chromosomal translocation. One of these genes, SCAMP5 is silenced on the derivative chromosome, and encodes a brain-enriched protein involved in membrane trafficking, similar to the previously identified candidate genes NBEA and AMISYN. Gene silencing of Nbea, Amisyn and Scamp5 in mouse beta-TC3 cells resulted in a 2-fold increase in stimulated secretion of large dense-core vesicles (LDCVs), while overexpression suppressed secretion. Moreover, ultrastructural analysis of blood platelets from the patients with haploinsufficieny of one of the three candidate genes, showed morphological abnormalities of dense-core granules, which closely resemble LDCVs. Taken together, this study shows that in three independent patients with autism three different negative regulators of LDCV secretion are affected, respectively, suggesting that in at least a subgroup of patients the regulation of neuronal vesicle trafficking may be involved in the pathogenesis of autism.

Drosophila rugoseIs a Functional Homolog of MammalianNeurobeachinand Affects Synaptic Architecture, Brain Morphology, and Associative Learning

“…The 5Јand 3Јfragments of ϳ5 kb of the rugose cDNA were cloned in pUAST with NotI, XhoI and MluI, XbaI, respectively. To clone the full-length cDNA of mouse Nbea in pUAST, a new multiple cloning site was generated by annealing and ligation of oligos 5Ј-aattcgttaacagatctgcggccgcttgtatctgaccggtagtggctctgactatgtcctgatttggaggc3Ј and 5Ј-tcgagcctccaaatcaggacatagtcagagccactaccggtcagatacaagcggccgcagatctgttaacg3Ј inpUASTdigestedwithEcoRIandXhoI.The5ЈterminusofNbeawasgenerated from the construct described by Castermans et al (2010) with primers 5Ј-ctaataaccggtatggcgagcgacaagccgggcccggggctag-3Ј and 5Ј-gggaggcaatgcaattgccgcagcactacacccagg-3Ј and cloned in pUAST with PinAI and AspI. The remaining part of Nbea was cloned with AspI and XhoI.…”

“…Blocking buffer [100 mM Tris/HCl, pH 7.4, 150 mM NaCl, 0.5% blocking reagent (Roche), and 0.2% Triton X-100] was used for blocking and antibody dilution. Primary antibodies used are rabbit anti-Rugose (1:2000; this study) and rabbit anti-Nbea (1:3000) (Castermans et al, 2010); mouse anti-actin (JLA20, 1:100; Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA) was used as a loading control. Secondary peroxidase-conjugated antibodies (1:2500) were from Dako.…”

“…NBEA is a multidomain scaffolding protein with an AKAP (A-kinase anchor protein) domain and is localized near the transGolgi network (TGN) (Wang et al, 2000), supporting a function in vesicle sorting or secretion as demonstrated by experiments performed in Nbea knock-out mice and in vitro (Wang et al, 2000;Su et al, 2004;Medrihan et al, 2009;Castermans et al, 2010;Niesmann et al, 2011). Whereas NBEA is known for its neuronal function and its implication in autism spectrum disorders (Castermans et al, 2003;Volders et al, 2011), the human homolog LRBA has a broad expression pattern, and its function is currently unknown (Wang et al, 2001).…”

Are Molecules Involved in Neuritogenesis and Axon Guidance Related to Autism Pathogenesis?

“…Recently, new genetic factors affecting neuritogenesis, growth cone changes, and vesicle and membrane trafficking have been identified as related to autism (Grice and Buxbaum 2006;Castermans et al 2010;Volders et al 2011;van Maldergem et al 2013). At least in a subgroup of patients, alterations in genes associated with neuronal vesicle trafficking (e.g., secretory carrier membrane protein 5-SCAMP5) coincide with the elaboration of mature synapses and may represent functional candidates for autism pathology (Castermans et al 2010).…”

SCAMP5 Plays a Critical Role in Synaptic Vesicle Endocytosis during High Neuronal Activity

“…This suggests a selective role for SCAMP5 in SV trafficking, but evidence for this is lacking. A recent study identified SCAMP5 as a candidate gene for autism and showed that it was silenced on a derivative chromosome and its expression was reduced to Ͻ40% in a patient with idiopathic, sporadic autism (Castermans et al, 2010). Therefore, the reduction in the expression of SCAMP5 may be related to the synaptic dysfunction observed in autistic patients.…”