Role of N-linked Oligosaccharide Chains in the Processing and Antigenicity of Measles Virus Haemagglutinin Protein

Hu, Aizhong; Cattaneo, Roberto; Schwartz, Stefan; Norrby, Erling

doi:10.1099/0022-1317-75-5-1043

Cited by 70 publications

(64 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1 A and 2), defining their orientation and possibly excluding spatial proximity of the N215-linked sugars. Previous studies (18) showed that two other potential N-linked sites (N168 and N187) are also sugar-modified, although those sugars were not visible in our crystal. Thus, wide areas of MV-H appear to be covered with N-linked sugars (SI Fig.…”

Section: Resultscontrasting

confidence: 43%

Crystal structure of measles virus hemagglutinin provides insight into effective vaccines

Hanabusa¹,

Kajikawa

Maita

et al. 2007

Proc. Natl. Acad. Sci. U.S.A.

225

260

View full text Add to dashboard Cite

Measles still remains a major cause of childhood morbidity and mortality worldwide. Measles virus (MV) vaccines are highly successful, but the mechanism underlying their efficacy has been unclear. Here we report the crystal structure of the MV attachment protein, hemagglutinin, responsible for MV entry. The receptorbinding head domain exhibits a cubic-shaped ␤-propeller structure and forms a homodimer. N-linked sugars appear to mask the broad regions and cause the two molecules forming the dimer to tilt oppositely toward the horizontal plane. Accordingly, residues of the putative receptor-binding site, highly conserved among MV strains, are strategically positioned in the unshielded area of the protein. These conserved residues also serve as epitopes for neutralizing antibodies, ensuring the serological monotype, a basis for effective MV vaccines. Our findings suggest that sugar moieties in the MV hemagglutinin critically modulate virus-receptor interaction as well as antiviral antibody responses, differently from sugars of the HIV gp120, which allow for immune evasion.x-ray crystallography paramyxovirus ͉ morbillivirus ͉ SLAM ͉ infectious disease ͉ paramyxovirus

show abstract

Section: Resultscontrasting

confidence: 43%

Crystal structure of measles virus hemagglutinin provides insight into effective vaccines

Hanabusa¹,

Kajikawa

Maita

et al. 2007

Proc. Natl. Acad. Sci. U.S.A.

225

260

View full text Add to dashboard Cite

show abstract

“…MV F protein function has more stringent requirements for glycosylation on all potential sites than H protein function: when tested in the same experimental system single-or double-site glycosylation mutants of the MV H proteins (Hu et al, 1994a) retained fusion-helper function, whereas only one of the single-site F protein glycosylation mutants retained fusion function. Indeed, the F and H proteins of MV, as with those of other paramyxoviruses have quite distinct properties regarding their intracellular processing (Mottet et al, 1986;Morrison & Portner, 1991 ;Hu et al, 1994a, b).…”

mentioning

confidence: 99%

“…To evaluate the possible contribution of N-linked oligosaccharide side chains on the H and F proteins to cell fusion, the F glycosylation mutants generated in this study and the previously produced H glycosylation mutants (Hu et al, 1994a) were co-expressed in HeLa T4 cells. All possible combinations between the F and H glycosylation mutants were used to cotransfect HeLa T4 cells and the capacity to cause cell fusion was determined under conditions described in Cattaneo & Rose (1993).…”

mentioning

confidence: 99%

“…Four 25-mer oligonucleotides with the desired mismatch nucleotide in the middle of sequences complementary to F cDNA sequences encoding the four Nlinked glycosylation consensus sites (Asn-X-Ser/Thr) were utilized to substitute codons for serine residues in place of those encoding asparagine residues. Oligonucleotide-directed site-specific mutagenesis was done as described previously (Hu et al, 1994a nated gl, g2 and g3, corresponding to Asn found at F protein residues 29, 61 and 67, respectively (Fig. 1 a).…”

mentioning

confidence: 99%

See 1 more Smart Citation

Influence of N-linked oligosaccharide chains on the processing, cell surface expression and function of the measles virus fusion protein

Cathomen

Cattaneo

et al. 1995

Journal of General Virology

Self Cite

View full text Add to dashboard Cite

show abstract

“…Recently, assessment of the role of individual sugar side chains can be done by utilizing site-directed mutagenesis of the consensus sequence (Asn-X-Thr/Ser) for oligosaccharide attachment. These studies reveal that role of the N-linked oligosaccharides on glycoprotein maturation varies from one glycoprotein to the other [2,7,10,12]. …”

mentioning

confidence: 99%

Loss of Glycosylation at Asn144 Alters the Substrate Preference of the N8 Influenza A Virus Neuraminidase.

Saito

Kawano

1997

The Journal of Veterinary Medical Science

View full text Add to dashboard Cite

ABSTRACT. Role of asparagine-linked (N-linked) oligosaccharide side chains in the maturation and the function of influenza virus neuraminidase (NA) subtype N8 was examined by site-directed mutagenesis and vaccinia virus expression system. Mutations in the consensus sequence for N-linked glycosylation at Asn 84 or 398 prevent the proper maturation of mutant NAs. On the contrary, mutation at Asn 144, that is conserved in all except two strains of influenza virus NA ever sequenced, did not affect the proper maturation and the transport of the mutant NA to the cell surface. Furthermore, this mutation led the alternation of substrate preference of this enzyme. These observations indicate that N-glycosylation at Asn 144 of N8 NA may be conserved from the functional requirement, but not from the structural necessity. -KEY WORDS: influenza virus, N-glycosylation, neuraminidase, site-directed mutagenesis.J. Vet. Med. Sci. 59(10): 923-926, 1997 glycosylation site at Asn 144 alters substrate preference of this enzyme. MATERIALS AND METHODS Virus, monoclonal antibodies (MAbs) and cells:Vaccinia virus WR strain, provided by Dr. B. Moss, was used for expression of mutant or wild type N8 NAs. MAbs raised against NA of A/duck/Ukraine/1/63 were reported elsewhere [14]. Madin-Darby canine kidney (MDCK) and human TK -143 cells were maintained in Eagle's minimal essential medium (MEM), supplemented with 5% newborn calf serum (NBCS).Site-directed mutagenesis: NA gene of A/duck/Ukraine/ 1/63 cloned into pSC11 (kindly provided by Dr. B. Moss) was designated as pSCN8. Site-directed mutagenesis on pSCN8 was carried out with Transformer TM Site-Directed Mutagenesis kit (Clontech). Three mutagenic primers, designated as HG-1, HG-2, and HG-3, respectively, were used along with selection primer HindIII-mut to abolish u n i q u e H i n d I I I s i t e w i t h i n p S C 1 1 ( H G -1 ; ACTTACATGAATAATAACGAAGCAATATGTGAT, HG-2; CTCAATGACAAACACTCATATGGAACAGTG AAGGAT-AGG, HG-3; GACAATTTGAATTGGAACGGA TACAGTGGATCT, HindIII-mut; CATGATTACGCCATG GTTTTGCGATCAATA). Sequence of N8 NA after mutagenesis was confirmed by autosequencer DSQ-1000 (Shimazu).Construction of vaccinia recombinants: Recombination of mutant or wild type NA gene with vaccinia WR strain was done as described elsewhere [9]. Resulting vaccinia recombinants, with N8 genes mutated by HG-1, HG-2 and HG-3 were designated as HG-1-Vac, HG-2-Vac and HG-3-Vac, respectively. Recombinant with wild type N8 NA was designated as N8-Vac. Asparagine-linked (N-linked) oligosaccharide side chains of glycoproteins not only provide solubility to nascent peptide chain within the endoplasmic reticulum (ER), but also serve as a receptor for ER chaperone(s) [4,6]. Role of N-linked oligosaccharide side chains on glycoproteins has been studied by treatment of cells with drugs, which abolish the addition of N-linked oligosaccharide side chains [5,15]. Recently, assessment of the role of individual sugar side chains can be done by utilizing site-directed mutagenesis of the consensus sequence (Asn-X-Thr/Ser) fo...

show abstract

Role of N-linked Oligosaccharide Chains in the Processing and Antigenicity of Measles Virus Haemagglutinin Protein

Abstract: The effects of N-linked oligosaccharides on the haemagglutinin (H) protein of measles virus (MV) were assessed with respect to the processing and antigenicity of the molecule. The functional glycosylation sites on the

Cited by 70 publications

References 38 publications

Crystal structure of measles virus hemagglutinin provides insight into effective vaccines

Crystal structure of measles virus hemagglutinin provides insight into effective vaccines

Influence of N-linked oligosaccharide chains on the processing, cell surface expression and function of the measles virus fusion protein

Loss of Glycosylation at Asn144 Alters the Substrate Preference of the N8 Influenza A Virus Neuraminidase.

Contact Info

Product

Resources

About