RNA interference is a functional pathway with therapeutic potential in human myeloid leukemia cell lines

Abstract

Background: RNA interference (RNAi) is a cellular pathway of gene silencing in a sequence-specific manner at the messenger RNA level. The basic mechanism behind RNAi is the breaking of a double-stranded RNA (dsRNA) matching a specific gene sequence into short pieces called short interfering RNA, which trigger the degradation of mRNA that matches its sequence. In this study, we explored the effects of RNAi in reducing the target gene expression in human myeloid leukemia cell lines. Methods: Four myeloid leukemia cell lines (HL-60, U937, THP-1, and K562) were transfected with dsRNA duplexes corresponding to the endogenous c-raf and bcl-2 genes and the gene expression inhibition was assessed. The effect of RNAi on cell differentiation was studied; the apoptosis induction and the sensitization of the leukemia cell lines to etoposide and daunorubicin were quantified by flowcytometric methods. Results: Transfection of the myeloid leukemia cell lines with dsRNA corresponding to c-raf and bcl-2 genes decreased the expression of Raf-1 and Bcl-2 proteins. RNAi for c-raf gene blocked the appearance of the monocytic differentiation induced by treatment with TPA. Combined RNAi for c-raf and bcl-2 induced apoptosis in HL-60, U937, and THP-1 cells and increased chemosensitivity to etoposide and daunorubicin. Conclusions: RNAi is a functional pathway in human myeloid leukemia cell lines and combined RNAi of c-raf and bcl-2 genes may represent a novel approach to leukemia, providing a means to overcome the resistance to chemotherapeutic agents and ultimately to augment the efficacy of chemotherapy in myeloid leukemia.

Specific downregulation of bcl-2 and xIAP by RNAi enhances the effects of chemotherapeutic agents in MCF-7 human breast cancer cells

“…This probably reflects the differences in the protective effect of Bcl-2 observed in breast cancer cells depending on the cytotoxic drug used. 44 It is very interesting to note that the concentration of bcl-2 siRNA used in the present study was much lower than the concentration of bcl-2 siRNA used in the very recent report of Cioca et al 24 Indeed, this report indicates that transfection with 800 nM bcl-2 siRNAs induced a minimal spontaneous apoptotic response in HL-60, U937 and THP-1 cell lines, 96 hours after transfection. In the work described here, a statistically significant increase in apoptosis was verified at that time and with a much smaller concentration of siRNAs (280 nM during the 3 hours of transfection and 55.6 nM thereafter).…”

“…19,20 Along this line, several recent studies have documented: (a) successful downregulation of BCR-ABL expression, resulting in increased apoptosis and decreased proliferation, in chronic myeloid leukemia cells; 21,22 (b) the MDR1 downregulation followed by chemosensitization of human pancreatic and gastric cell lines; 23 (c) combined inhibition of Bcl-2 and Raf-1 in human myeloid leukemia cells resulting in induction of apoptosis and chemosensitization. 24 Bearing in mind that RNAi is feasible in MCF-7 cell line [25][26][27] and that these cells are known to be relatively resistant to etoposide and doxorubicin, 28,29 the purpose of this study was to investigate if specific downregulation of bcl-2 or xIAP gene expression by RNAi sensitized MCF-7 cells to those chemotherapeutic drugs.…”

Hiwi Knockdown Inhibits the Growth of Lung Cancer in Nude Mice

“…Preclinical studies confirm that RNAi techniques can be used to silence cancer-related targets (Cioca et al, 2003;Scherr et al, 2003). In vivo studies have also shown favorable outcomes by RNAi targeting of components critical for tumor cell growth (Li et al, 2003), metastasis (Duxbury et al, 2004), angiogenesis (Filleur et al, 2003), and chemoresistance (Nakahira et al, 2007).…”

Fenoterol, a β2-adrenoceptor agonist, inhibits LPS-induced membrane-bound CD14, TLR4/CD14 complex, and inflammatory cytokines production through β-arrestin-2 in THP-1 cell line

“…The cells were washed and distributed into sterile microtiter plates at 10 6 /mL in RPMI-1640 medium containing 2% FBS stimulated with 0.1 µg/mL of Escherichia coli 0111:B4 LPS (Sigma) for 24 h (unless indicated otherwise) at 37 °C in the presence or absence of β 2 -AR agonists (fenoterol) and antagonists (ICI 118551) (both from Sigma). Downregulation (siRNA) of the β-arrestin-2 Cells were split at least 24 h prior to transfection and transfected with siRNA designed against β-arrestin-2 or control siRNA using the Oligofectamine™ transfection reagent (Invitrogen Life Technologies, Carlsbad, CA) according to the optimized procedure recommended by the producer as described elsewhere [15] . The siRNA sequence targeting β-arrestin-2 is 5' AAGGACCGCAAAGUGUUUGUG 3' (Shanghai GeneChem Co, Ltd, Shanghai,China).…”