RNA interference-based resistance in transgenic tomato plants against Tomato yellow leaf curl virus-Oman (TYLCV-OM) and its associated betasatellite

Abstract

BackgroundTomato yellow leaf curl virus (TYLCV), a monopartite begomovirus (family Geminiviridae) is responsible for heavy yield losses for tomato production around the globe. In Oman at least five distinct begomoviruses cause disease in tomato, including TYLCV. Unusually, TYLCV infections in Oman are sometimes associated with a betasatellite (Tomato leaf curl betasatellite [ToLCB]; a symptom modulating satellite). RNA interference (RNAi) can be used to develop resistance against begomoviruses at either the transcriptional or post-transcriptional levels.ResultsA hairpin RNAi (hpRNAi) construct to express double-stranded RNA homologous to sequences of the intergenic region, coat protein gene, V2 gene and replication-associated gene of Tomato yellow leaf curl virus-Oman (TYLCV-OM) was produced. Initially, transient expression of the hpRNAi construct at the site of virus inoculation was shown to reduce the number of plants developing symptoms when inoculated with either TYLCV-OM or TYLCV-OM with ToLCB-OM to Nicotiana benthamiana or tomato. Solanum lycopersicum L. cv. Pusa Ruby was transformed with the hpRNAi construct and nine confirmed transgenic lines were obtained and challenged with TYLCV-OM and ToLCB-OM by Agrobacterium-mediated inoculation. For all but one line, for which all plants remained symptomless, inoculation with TYLCV-OM led to a proportion (≤25%) of tomato plants developing symptoms of infection. For inoculation with TYLCV-OM and ToLCB-OM all lines showed a proportion of plants (≤45%) symptomatic. However, for all infected transgenic plants the symptoms were milder and virus titre in plants was lower than in infected non-transgenic tomato plants.ConclusionsThese results show that RNAi can be used to develop resistance against geminiviruses in tomato. The resistance in this case is not immunity but does reduce the severity of infections and virus titer. Also, the betasatellite may compromise resistance, increasing the proportion of plants which ultimately show symptoms.Electronic supplementary materialThe online version of this article (doi:10.1186/s12985-015-0263-y) contains supplementary material, which is available to authorized users.

Association of Tomato Yellow Leaf Curl Virus and Chili Leaf Curl Virus with Leaf Curl Disease of Radish and the Synergistic Interaction on Nicotiana benthamiana

“…The clone Rad-2/ChiLCV-OM was digested with BamH I and Sac I and the released fragment was ligated into the binary vector pCambia 1301. The remaining steps were as described by Ammara et al (2015).…”

“…Degenerate primers were designed and used to amplify the CP gene (Ammara et al, 2015), which was used to conduct diagnostic PCR of all infected and healthy plants. The PCR profile used in the thermal cycler was as explained by Ammara et al (2015).…”

“…Multiple sequence alignments and phylogenetic analysis were carried out as described by Ammara et al (2015).…”

“…To standardize and validate qPCR results, an internal control EF1 (EF1-F 5' TACTGGTGGTTTTGAAGCTG 3', EF1-R 5' AACTTCCTTCACGATTTCATCATA 3') was designed and used. Data analyses (reaction efficiency, Standard curve, melt curve analysis) was performed (Ammara et al, 2015).…”

Emerging threats of begomoviruses to the cultivation of medicinal and aromatic crops and their management strategies

“…Combination of Ty (Ty-1, and Ty2, Ty3, Ty4 and Ty5) gene has been reported in wild tomato to provide high level of resistance against Tomato yellow leaf curl virus (TYLCV). Homologous Ds RNA engineered to express sequence of IR, CP gene, V2 gene and replication associated gene of Tomato yellow leaf curl virus-Oman prepared to reduce the symptom development against TYLCV-OM in N. benthamiana/Tomato [8].…”