Retroviral insertional activation of the c-myb proto-oncogene in a Marek's disease T-lymphoma cell line

Rouzic, Erwann Le; Perbal, Bernard

doi:10.1128/jvi.70.11.7414-7423.1996

Cited by 9 publications

(6 citation statements)

References 72 publications

(81 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We have previously shown that T9 cells expressed high amounts of a truncated MYB protein as a result of RAV-1 integration within the c-myb allele. 32 A similar truncation conferred a transforming potential on myb, when assessed in primary chicken fibroblasts, 67 and related chimaeric mRNA was isolated from B lymphomas and fibrosarcomas induced by avian leukosis virus. 68 To our knowledge, this is the only report of a RAV insertional activation of c-myb in a T lymphoma.…”

Section: Discussionmentioning

confidence: 99%

“…PCR conditions were as described previously. 32 The primers for the pp38 gene used for amplification were as follows (5′ to 3′): pp38SD, GCTGCAGCTGTCCATTTTCC; pp38SI, GCCATCCTTGTCTTTCTGCC; and pp38I, CTGCTTCGAATTCCAT-CACC (nt 1529 to 1549, 2564 to 2584, and 2500 to 2519, 10 respectively). The primer for the pp24 gene was as follows: pp24SI, ACCCCGTAACCAGCATGATG (nt 1411 to 1431 43 ).…”

Section: Rna Purification and Analysismentioning

confidence: 99%

“…To establish whether tumours arising in T9 infected birds originate from an expansion of the injected tumour cells or from MDV induced transformation, we took advantage of the previously reported activation of c-myb in T9 cells 32 and performed MHC typing. Using primers specific for the 5′ myb-RAV junction in T9 cells 32 no products were amplified from DNA derived from either early T9 induced tumours or tissues from late T9 inoculated chickens ( fig 8C).…”

Section: Pathogenicity Of the MDV Cell Lines In Vivomentioning

confidence: 99%

“…These results sug-gested that the maintenance of the transformed state was dependent upon the presence of a truncated c-MYB protein. 32 To test this hypothesis, we analysed the putative oncogenic regions from the MDV in the T9 cell lines. Here, we report that, except for the meq gene, MDV regions encoding putative oncogenes are altered in T9 cells, therefore raising the possibility that maintenance of transformation in this cell line might require cooperation between the meq and truncated myb oncogenes.…”

mentioning

confidence: 99%

See 3 more Smart Citations

Alterations of the MDV oncogenic regions in an MDV transformed lymphoblastoid cell line

Rouzic

Thoraval²,

Afanassieff³

et al. 2002

Molecular Pathology

Self Cite

View full text Add to dashboard Cite

Aims: Lymphoblastoid cell lines derived from Marek's disease virus (MDV) induced tumours have served as models of MDV latency and transformation. They are stable and can be cultured with no detectable MDV genomic alterations upon repeated passaging. An MDV transformed lymphoblastoid T cell line (T9 cell line) has been reported to contain a disrupted MDV BamHI-H fragment and a Rous associated virus insertional activation of the c-myb protooncogene. In an attempt to define the respective participation of c-myb and MDV in the transformed phenotype of T9 cells, an analysis of MDV oncogenic sequences (BamHI-H, BamHI-A, and EcoQ fragments) was performed in these cells. Methods: Using two different passages of the T9 cell line (late and early passages), the organisation of the MDV oncogenic regions and their expression in these cells were analysed. In vivo assessment of the oncogenicity of the virus contained within these cells was assessed by injecting them into 1 day old chickens. Results: In T9 cells maintained in culture for up to six months (late T9), the MDV ICP4 gene was disrupted, whereas the meq gene was actively transcribed. The alterations of the MDV genome in these cells correlated with the inability of the virus to induce the classic signs of Marek's disease in 1 day old chickens. However, early T9 cells submitted to a limited number of passages induced classic MDV pathogenicity, as efficiently as the MDV control cell line (T5), and did not show gross structural changes in the oncogenic MDV sequences. Conclusions: Although the expression pattern of the MDV oncogenes in early T9 cells was identical to the one reported for other MDV transformed cells, longterm culture of an MDV transformed cell line containing a RAV insertional activation of the c-myb protooncogene led to the disruption of the MDV BamHI-H and BamHI-A oncogenic regions. In the late T9 cells MEQ was the only detected MDV oncoprotein. These results suggest that in the late T9 cells the truncated MYB protein compensates for the loss of MDV oncoproteins and reinforce the possibility that MEQ and MYB cooperate in the maintenance of the transformed state and the tumorigenic potential of these cells.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Rna Purification and Analysismentioning

confidence: 99%

Section: Pathogenicity Of the MDV Cell Lines In Vivomentioning

confidence: 99%

mentioning

confidence: 99%

See 2 more Smart Citations

Alterations of the MDV oncogenic regions in an MDV transformed lymphoblastoid cell line

Rouzic

Thoraval²,

Afanassieff³

et al. 2002

Molecular Pathology

Self Cite

View full text Add to dashboard Cite

show abstract

“…The retroviral insertion sites are two, 1 kb region each at the junction of the short unique and short repeat regions of the MDV genome. To the malignancy of a MDV-transformed lymphoma cell line, REV contributed the activation of the c-myb (myeloblast) proto-oncogene [225]. A clone of MDV derived through REV genomic insertion exhibited attenuated oncogenicity, but remained infectious by contact, caused thymic and bursal atrophy and induced severe immunosuppression [226].…”

Section: Reticuloendotheliosis Virus Genomic Sequences In the Marek'smentioning

confidence: 99%

Horizontal Gene Transfers with or without Cell Fusions in All Categories of the Living Matter

Sinkovics

2011

Advances in Experimental Medicine and Biology

View full text Add to dashboard Cite

This article reviews the history of widespread exchanges of genetic segments initiated over 3 billion years ago, to be part of their life style, by sphero-protoplastic cells, the ancestors of archaea, prokaryota, and eukaryota. These primordial cells shared a hostile anaerobic and overheated environment and competed for survival. "Coexist with, or subdue and conquer, expropriate its most useful possessions, or symbiose with it, your competitor" remain cellular life's basic rules. This author emphasizes the role of viruses, both in mediating cell fusions, such as the formation of the first eukaryotic cell(s) from a united crenarchaeon and prokaryota, and the transfer of host cell genes integrated into viral (phages) genomes. After rising above the Darwinian threshold, rigid rules of speciation and vertical inheritance in the three domains of life were established, but horizontal gene transfers with or without cell fusions were never abolished. The author proves with extensive, yet highly selective documentation, that not only unicellular microorganisms, but the most complex multicellular entities of the highest ranks resort to, and practice, cell fusions, and donate and accept horizontally (laterally) transferred genes. Cell fusions and horizontally exchanged genetic materials remain the fundamental attributes and inherent characteristics of the living matter, whether occurring accidentally or sought after intentionally. These events occur to cells stagnating for some 3 milliard years at a lower yet amazingly sophisticated level of evolution, and to cells achieving the highest degree of differentiation, and thus functioning in dependence on the support of a most advanced multicellular host, like those of the human brain. No living cell is completely exempt from gene drains or gene insertions.

show abstract

C-Myb And Leukaemogenesis

Bies

Wolff

2004

Myb Transcription Factors: Their Role in Growth, Differentiation and Disease

View full text Add to dashboard Cite

Retroviral insertional activation of the c-myb proto-oncogene in a Marek's disease T-lymphoma cell line

Cited by 9 publications

References 72 publications

Alterations of the MDV oncogenic regions in an MDV transformed lymphoblastoid cell line

Alterations of the MDV oncogenic regions in an MDV transformed lymphoblastoid cell line

Horizontal Gene Transfers with or without Cell Fusions in All Categories of the Living Matter

C-Myb And Leukaemogenesis

Contact Info

Product

Resources

About