Reply to Comment on Watanabe, A.; Kadota, Y.; Yokoyama, H.; Tsuruda, S.; Kamio, R.; Tochio, T.; Shimomura, Y.; Kitaura, Y. Experimental Determination of the Threshold Dose for Bifidogenic Activity of Dietary 1-Kestose in Rats. Foods 2020, 9, 4

Watanabe, Ayako; Kadota, Yasuhiro; Tochio, Takumi; Shimomura, Yoshiharu; Kitaura, Yasuyuki

doi:10.3390/foods9040527

Cited by 3 publications

(1 citation statement)

References 24 publications

(1 reference statement)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This linear combination has been previously suggested to exist in some parameter regions of various models for κ-type charge-transfer salts. [86][87][88] Considering this result, the superconducting gap on the Fermi surface was suggested to have a form ΔðkÞ…”

Section: Disorder Induced Dos Featuresmentioning

confidence: 99%

Investigation of Many‐Body Effects in the Quasi‐Two‐Dimensional Electronic System of Organic Charge‐Transfer Salts

Mashoff

Regel

Medjanik

et al. 2019

Physica Status Solidi (b)

View full text Add to dashboard Cite

This article reviews recent progress in the understanding of many‐body effects in the quasi‐two‐dimensional electronic system of organic charge‐transfer salts using element‐selective X‐ray absorption and scanning tunneling spectroscopy techniques. A few previously unpublished topographical scanning tunneling microscopy images illustrate structural consequences of the charge transfer mechanism. The first part of the review focuses on the understanding of the charge transfer between acceptor and donor molecules in general. Results for dithiophene‐based organic semiconductors as a representative model system is reviewed that is relevant for electronic applications, too. Experimental results are used to develop appropriate calculation schemes with large predictive power. The combination of experiment and theory reveals a charge transfer mechanism that is more complex than just the interaction of single HOMO and LUMO states in donor and acceptor molecules. The second part of the review highlights the emergence of superconductivity as a result of the charge transfer leaving strongly correlated and partly occupied electronic states at the Fermi level. The authors review recent experimental results for the κ‐phase organic superconductors obtained with scanning tunneling spectroscopy and compare the temperature‐dependent local density of states function with theoretical approaches. The superconducting order parameter for κ‐(ET)2Cu[N(CN)2]Br reveals an eight‐node gap structure resulting from a strongly anisotropic mixed‐symmetry superconducting gap.

show abstract

Section: Disorder Induced Dos Featuresmentioning

confidence: 99%

Investigation of Many‐Body Effects in the Quasi‐Two‐Dimensional Electronic System of Organic Charge‐Transfer Salts

Mashoff

Regel

Medjanik

et al. 2019

Physica Status Solidi (b)

View full text Add to dashboard Cite

show abstract

Comment on Experimental Determination of the Threshold Dose for Bifidogenic Activity of Dietary 1-Kestose in Rats. Foods 2020, 9, 4

Shen

Yang

Sun

2020

Foods

View full text Add to dashboard Cite

Currently, our group is undertaking a program trying to evaluate the bifidogenic effect/activity of different prebiotics and their dose-effect relationships. Therefore, we were interested to read an article reported the determination of the minimal threshold dose for the bifidogenic activity of dietary 1-kestose in rats published in Foods in December 2019 [1]. It was reported that Bifidobacterium spp. preferentially metabolized fructo-oligosaccharides (FOSs) with a lower degree of polymerization [2]. As the major component of FOSs with the smallest molecular weight, determination of its minimal threshold dose for the bifidogenic activity of 1-kestose in foods is definitely important. However, we have some concerns, especially on the methodological drawbacks, which may be critical to this report.Watanabe et al. measured cecal microbiota populations using quantitative real-time polymerase chain reaction (qPCR) technology [1]. The 16S rRNA was amplified as a target gene for quantification of Bifidobacterium spp. using a pair of primers (F: GATTCTGGCTCAGGATGAACGC; R: CTGATAGGACGCGACCCCAT). The authors provided a reference (Reference 8) for the primers. However, we noticed that paper enumerated Bifidobacterium spp. by traditional cell counting on agar plate other than qPCR amplification [3]. It is obvious the citation is incorrect.Then, we found the above primers in another paper, which came from the same research group, in which a similar experiment was conducted investigating the effect of 1-kestose within a range of 0.5-5.0% [4]. In this paper, the primers have the same sequences but different names (Bif LM26F/Bif 228R). Although it was primarily designed based only on the corresponding gene of Bifidobacterium longum subsp. longum JCM 1217 T (B. longum), this pair of primers was used as the Bifidobacterium genus specific primer. In fact, the primers (Bif LM26F/Bif 228R) were first designed in 2004 [5]. The applicability/university of the primers was evaluated with 10 type strains of Bifidobacterium spp., representing 10 different species. The specificity of the primers was checked with 21 type strains of nonbfidobacerial strains. Thereafter, the primers were used in many studies. However, we now know there are more than 88 species in the genus of Bifidobacterium and the diversity of gut microbiota is quite high [6]. Therefore, we wonder whether the primers are reliable for genus-specific amplification.To support our speculation, we performed a specificity check of this pair of primers using Primer-BLAST with default settings [7]. Results produced online indicate both the specificity and universality of this pair of primers are questionable. According to this prediction, the primers yield 230 bp amplicons from different genera of bacteria, targeting the 16S rRNA gene. It was equally efficient for Gardnerella spp., Scardovia inopinata, and Parascardovia denticolens, albeit could amplify many species of Bifidobacterium spp. Unfortunately, representatives of these bacteria were not included in the original study [5]. E...

show abstract