Relative Stability of Quadruplexes Containing Different Number of G-Tetrads

Petraccone, Luigi; Erra, Eva; Duro, Ida; Esposito, Veronica; Randazzo, Antonio; Mayol, Luciano; Mattia, Carlo Andrea; Barone, G.; Giancola, Concetta

doi:10.1081/ncn-200060080

Cited by 15 publications

(11 citation statements)

References 3 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Independent in vitro mtDNA assays showed that shorter guanine tracts resulted in fourfold decreased replication primer formation ( 22 ). Biochemical observations confirm that G-quadruplexes formed with more guanine residues are more thermodynamically stable ( 60 ), and sequence-independent investigation shows that smaller nucleotide loops between guanine residues also stabilise the G-quadruplex ( 61 ). Taken together, these observations suggest a picture where more guanine residues, more tightly associated, produce stronger G-quadruplex structures ( 62 ), which more readily stall transcription ( 59 ) and thus more readily yield replication primers ( 22 ) (Figure 3B ).…”

Section: Resultsmentioning

confidence: 81%

“…To our knowledge, no software tools yet exist that can make thermodynamic predictions about intermolecular DNA-RNA quadruplex stability (although a predictor for such structures does exist ( 69 )). However, as we have argued above, insights from the more general literature on intramolecular G-quadruplexes ( 60–62 ) are informative, entropic arguments suggest than long G-tracts increase stability, and this theory is borne out by mtDNA-specific experimental observations of subsequent replication behaviour ( 22 ).…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

MtDNA sequence features associated with ‘selfish genomes’ predict tissue-specific segregation and reversion

Røyrvik

Johnston

2020

Nucleic Acids Research

View full text Add to dashboard Cite

Mitochondrial DNA (mtDNA) encodes cellular machinery vital for cell and organism survival. Mutations, genetic manipulation, and gene therapies may produce cells where different types of mtDNA coexist in admixed populations. In these admixtures, one mtDNA type is often observed to proliferate over another, with different types dominating in different tissues. This ‘segregation bias’ is a long-standing biological mystery that may pose challenges to modern mtDNA disease therapies, leading to substantial recent attention in biological and medical circles. Here, we show how an mtDNA sequence’s balance between replication and transcription, corresponding to molecular ‘selfishness’, in conjunction with cellular selection, can potentially modulate segregation bias. We combine a new replication-transcription-selection (RTS) model with a meta-analysis of existing data to show that this simple theory predicts complex tissue-specific patterns of segregation in mouse experiments, and reversion in human stem cells. We propose the stability of G-quadruplexes in the mtDNA control region, influencing the balance between transcription and replication primer formation, as a potential molecular mechanism governing this balance. Linking mtDNA sequence features, through this molecular mechanism, to cellular population dynamics, we use sequence data to obtain and verify the sequence-specific predictions from this hypothesis on segregation behaviour in mouse and human mtDNA.

show abstract

Section: Resultsmentioning

confidence: 81%

Section: Discussionmentioning

confidence: 99%

MtDNA sequence features associated with ‘selfish genomes’ predict tissue-specific segregation and reversion

Røyrvik

Johnston

2020

Nucleic Acids Research

View full text Add to dashboard Cite

show abstract

“…These results are consistent with the NMR spectroscopy results in the presence of higher concentrations of salt, indicating the presence of multiple G quadruplex conformations and/or possible aggregation. It is known that the stability of G quadruplexes highly depends on their architecture, with more G quartet planes stacked within the G quadruplex increasing the overall thermodynamic stability of the structure 28 . In our proposed 32-nt NR2B mRNA fragment, there is only one three-plane intramolecular G quadruplex that could be possibly formed due to existence of only four guanine triplets (underlined in figure 1A), and other G quadruplex structures would involve less stable two-plane arrangements.…”

Section: Resultsmentioning

confidence: 99%

Fragile X mental retardation protein interactions with a G quadruplex structure in the 3′-untranslated region of NR2B mRNA

et al. 2015

View full text Add to dashboard Cite

Fragile X syndrome, the most common cause of inherited intellectual disability, is caused by a trinucleotide CGG expansion in the 5′-untranslated region of the FMR1 gene, which leads to the loss of expression of the fragile X mental retardation protein (FMRP). FMRP, an RNA-binding protein that regulates the translation of specific mRNAs, has been shown to bind a subset of its mRNA targets by recognizing G quadruplex structures. It has been suggested that FMRP controls the local protein synthesis of several protein components of the Post Synaptic Density (PSD) in response to specific cellular needs. We have previously shown that the interactions between FMRP and mRNAs of the PSD scaffold proteins PSD-95 and Shank1 are mediated via stable G-quadruplex structures formed within the 3′-untranslated regions of these mRNAs. In this study we used biophysical methods to show that a comparable G quadruplex structure forms in the 3′-untranslated region of the glutamate receptor subunit NR2B mRNA encoding for a subunit of N-methyl-D-aspartate (NMDA) receptors that is recognized specifically by FMRP, suggesting a common theme for FMRP recognition of its dendritic mRNA targets.

show abstract

“…For example, the human telomeric motif can adopt an antiparallel configuration in the presence of sodium ions, but has been shown to adopt an all-parallel conformation in the presence of potassium ions (14,54,55). Furthermore, sequences exist that form very unusual and unpredictable structures: c-kit87up wd(AGGGAGGGCGCTGGGAGGAGGG)x folds in such a way that a singular non-G-tract G participates in the formation of a G-tetrad core, despite the presence of four Gtracts in the sequence that each contain three consecutive G units (56,57).…”

Section: Methods To Study G-quadruplexesmentioning

confidence: 99%

“…In silico studies have found that both prokaryotic and eukaryotic genomes contain many PQSs (39,69,70). They are particularly abundant in both the G-rich telomere sequences found at the ends of chromosomes and in eukaryotic gene promoters (39,56,70,72,73). They are particularly abundant in both the G-rich telomere sequences found at the ends of chromosomes and in eukaryotic gene promoters (39,56,70,72,73).…”

Section: Do G-quadruplexes Form In Vivo?mentioning

confidence: 99%

Seven essential questions on G-quadruplexes

König¹,

Evans

Huppert

2010

BioMolecular Concepts

View full text Add to dashboard Cite

The helical duplex architecture of DNA was discovered by Francis Crick and James Watson in 1951 and is well known and understood. However, nucleic acids can also adopt alternative structural conformations that are less familiar, although no less biologically relevant, such as the G-quadruplex. G-quadruplexes continue to be the subject of a rapidly expanding area of research, owing to their significant potential as therapeutic targets and their unique biophysical properties. This review begins by focusing on G-quadruplex structure, elucidating the intermolecular and intramolecular interactions underlying its formation and highlighting several substructural variants. A variety of methods used to characterize these structures are also outlined. The current state of G-quadruplex research is then addressed by proffering seven pertinent questions for discussion. This review concludes with an overview of possible directions for future research trajectories in this exciting and relevant field.

show abstract

Relative Stability of Quadruplexes Containing Different Number of G-Tetrads

Cited by 15 publications

References 3 publications

MtDNA sequence features associated with ‘selfish genomes’ predict tissue-specific segregation and reversion

MtDNA sequence features associated with ‘selfish genomes’ predict tissue-specific segregation and reversion

Fragile X mental retardation protein interactions with a G quadruplex structure in the 3′-untranslated region of NR2B mRNA

Seven essential questions on G-quadruplexes

Contact Info

Product

Resources

About