Regulation of olfactory-based sex behaviors in the silkworm by genes in the sex-determination cascade

Abstract

Insect courtship and mating depend on integration of olfactory, visual, and tactile cues. Compared to other insects, Bombyx mori, the domesticated silkworm, has relatively simple sexual behaviors as it cannot fly. Here by using CRISPR/Cas9 and electrophysiological techniques we found that courtship and mating behaviors are regulated in male silk moths by mutating genes in the sex determination cascade belonging to two conserved pathways. Loss of Bmdsx gene expression significantly reduced the peripheral perception of the major pheromone component bombykol by reducing expression of the product of the BmOR1 gene which completely blocked courtship in adult males. Interestingly, we found that mating behavior was regulated independently by another sexual differentiation gene, Bmfru. Loss of Bmfru completely blocked mating, but males displayed normal courtship behavior. Lack of Bmfru expression significantly reduced the perception of the minor pheromone component bombykal due to the down regulation of BmOR3 expression; further, functional analysis revealed that loss of the product of BmOR3 played a key role in terminating male mating behavior. Our results suggest that Bmdsx and Bmfru are at the base of the two primary pathways that regulate olfactory-based sexual behavior.

5′-Nucleotidase Plays a Key Role in Uric Acid Metabolism of Bombyx mori

“…One plasmid, pBac [IE1-EGFP-nos-Cas9], reported in our previous studies, used the B. mori nos promoter to drive Cas9 nuclease expression together with an IE1 promoter to drive EGFP expression as a selectable marker. We used a second plasmid, pBac [IE1-DsRed2], as a DsRed selectable marker to identify transgenic plasmids expressing Bm5′N single guide RNAs (sgRNAs) [ 29 ]. Details of the construction of the guide RNA plasmid and the Cas9 plasmid were described previously [ 30 , 31 ].…”

“…The transgenic silkworm strain and the nos-Cas9 line were previously reported [ 29 , 30 ]. We injected U6-sgRNAs and helper plasmids into G0 blastoderm embryos maintained at 25 °C in a humidified environment 10 days prior to hatching.…”

Protein visualization and manipulation in Drosophila through the use of epitope tags recognized by nanobodies

“…NbVHH05 or Nb127D01 was cloned from pHEN6-VHH05 or pHEN6-127D01 (Ploegh lab). GFP was amplified from PXL-IE1-EGFP-nos-Cas9 ( Xu et al, 2020 ). PCR fragments were joined together with the digested pW10 backbone by Gibson assembly.…”

Mutation of Serine protease 1 Induces Male Sterility in Bombyx mori

“…BmSer1-KO-F GTGGGAGTACTATTACGGGAAG BmSer1-KO-R CTATCGATAAACGTAGCGGCGT protein (EGFP) marker under control of the IE1 promoter as reported in our previous study (Nakao et al, 2008;Xu et al, 2019Xu et al, , 2020a. The effector plasmid was pBac[IE1-DsRed2-U6-sgRNA] (U6-sgRNA), which results in expression of the sgRNA under control of the silkworm U6 promoter and the DsRed fluorescence marker under control of the IE1…”