Regulation of herpes simplex virus true late gene expression: sequences downstream from the US11 TATA box inhibit expression from an unreplicated template

Abstract

The true late genes of herpes simplex virus type 1 (HSV-1) are expressed only after the onset of viral DNA replication. Previous studies demonstrated that late promoters lack elements upstream of the TATA box and suggested that only a subset of TATA elements can function in the context of true late promoters. We determined which structural features of true late promoters are responsible for the stringent requirement for viral DNA replication by inserting a series of simple model constructs into the HSV-1 genome in place of one of the two promoters of the UL24 gene. An oligonucleotide consisting of 19 nucleotides spanning the TATA box of the HSV-1 true late US)) gene drove barely detectable levels of expression; by contrast, the corresponding regions of the Adenovirus type 2 major late promoter and the HSV-1 true late glycoprotein C promoter were much more active. Transcripts driven from all of these minimal TATA box promoters accumulated without viral DNA replication. The activity of the US)) TATA box was stimulated by adding upstream Spl-binding sites or placing the US)) or rabbit 13-globin cap/leader region (-11 to +39) downstream. The Spl-TATA and TATA-j8-globin cap/leader constructs remained replication independent, while the TATA-USII cap/leader promoter displayed true late regulation. These results demonstrate that sequences located within the US)) cap/leader region impose a strict requirement for viral DNA replication on a minimal TATA box promoter.

Substitution of a TATA box from a herpes simplex virus late gene in the viral thymidine kinase promoter alters ICP4 inducibility but not temporal expression

“…The data presented here suggest that this restriction is not due to any of the defined sequences in early or late gene promoters that bind to cellular transcription factors. It has been proposed that sequences present in the 5' untranslated leader sequences of late genes contribute to late gene expression (26,32). Such sequences could bind to a cellular or viral protein that represses transcription by preventing the formation of an active transcription initiation complex.…”

Oncolytic Herpes Simplex Virus Counteracts the Hypoxia-Induced Modulation of Glioblastoma Stem-Like Cells

“…The Us11 promoter was polymerase chain reaction (PCR)‐cloned from the genome of wild‐type HSV‐1 strain F using the following primers: forward primer, CCGGATCCTGAGATCAATAAAAGGGGGCGTGAG, and reverse primer, CCGCCATGGTCCGCCCAGAGACTCGGGTGATG. This promoter sequence contains the following cis ‐acting regulatory elements of HSV‐1 late promoters: the TATA box and the cap/leader sequences (initiator element), which together confer true late regulation, as well as the downstream activation sequence that allows transcriptional activation [36, 37]. The Us11 promoter and the luciferase gene codon‐optimized for mammalian expression (from pGL4.10[luc2]; Promega, Madison, WI, http://www.promega.com) were subcloned into shuttle plasmid pFLS‐IE4‐Express, removing the HSV IE4 promoter.…”

Replication of Herpes Simplex Virus Type 1 within Trigeminal Ganglia Is Required for High Frequency but Not High Viral Genome Copy Number Latency

“…The ␤-Gal minigene in 17/tBTK Ϫ was inserted upstream of UL24, a viral gene that is partially antisense to TK and is required for efficient viral replication (6,19,21). UL24 mRNA is transcribed from three different promoters (23,37), the most distal of which was disrupted by the insertion. To determine the effect of the insertion on UL24 mRNA expression, RSC monolayers were infected with 17/tBTK Ϫ or 17/tBRTK ϩ and employed as a source of mRNA for RNA blot analysis (Fig.…”