Redirection of T Cell Effector Function In Vivo and Enhanced Collagen-Induced Arthritis Mediated by an IL-2Rβ/IL-4Rα Chimeric Cytokine Receptor Transgene

Abstract

Chronic inflammatory autoimmune diseases such as diabetes, experimental autoimmune encephalomyelitis, and collagen-induced arthritis (CIA) are associated with type 1 (Th1, Tc1) T cell-dependent responses against autoantigens. Immune deviation toward type 2 (Th2, Tc2) response has been proposed as a potential means of gene therapy or immunomodulation to treat autoimmune diseases based on evidence that type 2 cytokines can prevent or alleviate these conditions. In this report we assessed the effects of elevated type 2 responses on CIA using transgenic mice expressing an IL-2Rβ/IL-4Rα chimeric cytokine receptor transgene specifically in T cells. In response to IL-2 binding, this chimeric receptor transduces IL-4-specific signals and dramatically enhances type 2 responses. In contrast to published reports of Th2-mediated protection, CIA was exacerbated in IL-2Rβ/IL-4Rα chimeric receptor transgenic mice, with increased disease incidence, severity, and earlier disease onset. The aggravated disease in transgenic mice was associated with an increase in type 2 cytokines (IL-4, IL-5, IL-10) and an increase in collagen-specific IgG1 levels. However, IFN-γ production is not affected significantly in the induction phase of the disease. There is also an extensive eosinophilic infiltration in the arthritic joints of the transgenic animal, suggesting a direct contribution of type 2 response to joint inflammation. Taken together, our findings provide novel evidence that enhancement of a polyclonal type 2 response in immunocompetent hosts may exacerbate an autoimmune disease such as CIA, rather than serving a protective role. This finding raises significant caution with regard to the potential use of therapeutic approaches based on immune deviation toward type 2 responses.

Differential Regulation of Osteoblast Activity by Th Cell Subsets Mediated by Parathyroid Hormone and IFN-γ

“…On the Th2 side, opposing effects of IL-4 have also been documented. Studies of IL-4 gene deletion and enhanced IL-4 signaling demonstrated a role of IL-4 in accelerating the onset and severity of arthritis (21,24), whereas others found that IL-4 was protective against arthritis (25,26). These findings underscored the complex nature of inflammatory arthritis as a heterogeneous group of diseases with different underlying mechanisms subject to influences by genetic backgrounds and stages of disease.…”

Valproate‐induced neural tube defects in folate‐binding protein‐2 (Folbp2) knockout mice

“…Bcl‐ X L transgenic mice homozygous for H‐2 q were then further backcrossed to DBA/1 for 6 additional generations (F 1 N 7 ). Collagen‐specific Vβ8.3 transgenic mice were provided by one of the authors (ER) (14). Primer set 5′‐CTCTTCTAGAACACATGGAGG‐3′ and 5′‐GACAGACAGCTTGGTTCCATG‐3′ was used to amplify a 346‐bp product of the Vβ8.3 gene.…”

Constitutive expression of BCL‐XL in the T lineage attenuates collagen‐induced arthritis in Bcl‐XL transgenic mice

“…Bcl-x L transgenic mice homozygous for H-2 q were then further backcrossed to DBA/1 for 6 additional generations (F 1 N 7 ). Collagen-specific V␤8.3 transgenic mice were provided by one of the authors (ER) (14). Primer set 5Ј-CTCTTCTAGAACACATGGAGG-3Ј and 5Ј-GACAGACAGCTTGGTTCCATG-3Ј was used to amplify a 346-bp product of the V␤8.3 gene.…”