Recombinogenic Properties of Pyrococcus furiosus Strain COM1 Enable Rapid Selection of Targeted Mutants

Farkas, Joel; Stirrett, Karen; Lipscomb, Gina L.; Nixon, William; Scott, Robert A.; Adams, Michael W. W.; Westpheling, Janet

doi:10.1128/aem.00936-12

Cited by 50 publications

(45 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The marker cassette for uracil prototrophic selection consisted of the pyrF gene driven by the promoter region of the glutamate dehydrogenase gene (consisting of a 157 base sequence immediately upstream of locus PF1602) and terminated with 12 bases of the 3′ UTR of the hpyA1 gene (5′-aatcttttttag, locus PF1722). A 65-b sequence of the 3′ end of the marker cassette (5′-ctaaaaaagattttatcttgagctccattctttcacctcctcgaaaatcttcttagcggcttccc) was repeated at the beginning of the cassette to serve as a homologous recombination region for selection of marker removal (27). Plasmid pGL007 targeting homologous recombination at the PF0574-PF0575 intergenic space was constructed by cloning the SOE-PCR product into plasmid pJHW006 (28) (Fig.…”

Section: Methodsmentioning

confidence: 99%

Exploiting microbial hyperthermophilicity to produce an industrial chemical, using hydrogen and carbon dioxide

Keller

Schut

Lipscomb

et al. 2013

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

116

103

View full text Add to dashboard Cite

Microorganisms can be engineered to produce useful products, including chemicals and fuels from sugars derived from renewable feedstocks, such as plant biomass. An alternative method is to use low potential reducing power from nonbiomass sources, such as hydrogen gas or electricity, to reduce carbon dioxide directly into products. This approach circumvents the overall low efficiency of photosynthesis and the production of sugar intermediates. Although significant advances have been made in manipulating microorganisms to produce useful products from organic substrates, engineering them to use carbon dioxide and hydrogen gas has not been reported. Herein, we describe a unique temperature-dependent approach that confers on a microorganism (the archaeon Pyrococcus furiosus, which grows optimally on carbohydrates at 100°C) the capacity to use carbon dioxide, a reaction that it does not accomplish naturally. This was achieved by the heterologous expression of five genes of the carbon fixation cycle of the archaeon Metallosphaera sedula, which grows autotrophically at 73°C. The engineered P. furiosus strain is able to use hydrogen gas and incorporate carbon dioxide into 3-hydroxypropionic acid, one of the top 12 industrial chemical building blocks. The reaction can be accomplished by cell-free extracts and by whole cells of the recombinant P. furiosus strain. Moreover, it is carried out some 30°C below the optimal growth temperature of the organism in conditions that support only minimal growth but maintain sufficient metabolic activity to sustain the production of 3-hydroxypropionate. The approach described here can be expanded to produce important organic chemicals, all through biological activation of carbon dioxide.

show abstract

Section: Methodsmentioning

confidence: 99%

Exploiting microbial hyperthermophilicity to produce an industrial chemical, using hydrogen and carbon dioxide

Keller

Schut

Lipscomb

et al. 2013

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

116

103

View full text Add to dashboard Cite

show abstract

“…Trace element solution SL-10 is prepared as described previously (23), and the 200ϫ vitamin solution contained the following vitamins (in milligrams) per liter: biotin, 4; folic acid, 4; pyridoxine-HCl, 20; riboflavin, 10; thiamineHCl, 10; nicotinic acid 10; pantothenic acid, 10; vitamin B 12 , 0.2; p-aminobenzoic acid, 10; and lipoic acid, 10. Unless otherwise indicated, C. bescii was routinely cultured under strict anaerobic conditions at 75°C with shaking at 200 rpm in LOD medium (22), with the exception that maltose was replaced with cellobiose and sodium molybdate and sodium tungstate were added at final concentrations of 1 M. Pyrococcus furiosus strain COM1 (24) was cultured under strict anaerobic conditions at 90°C in static bottles in artificial seawater medium containing per liter: 5 g of maltose, 1ϫ base salts (23), 1ϫ trace minerals (23), 10 M sodium tungstate, 0.25 g of resazurin, 2 g of yeast extract, 0.5 g of cysteine, 0.5 g sodium sulfide, 1 g of sodium bicarbonate, 1 mM potassium phosphate buffer (pH 6.8), and 20 M uracil.…”

Section: Methodsmentioning

confidence: 99%

A New Class of Tungsten-Containing Oxidoreductase in Caldicellulosiruptor, a Genus of Plant Biomass-Degrading Thermophilic Bacteria

Scott

Rubinstein

Lipscomb

et al. 2015

Appl Environ Microbiol

Self Cite

View full text Add to dashboard Cite

bCaldicellulosiruptor bescii grows optimally at 78°C and is able to decompose high concentrations of lignocellulosic plant biomass without the need for thermochemical pretreatment. C. bescii ferments both C 5 and C 6 sugars primarily to hydrogen gas, lactate, acetate, and CO 2 and is of particular interest for metabolic engineering applications given the recent availability of a genetic system. Developing optimal strains for technological use requires a detailed understanding of primary metabolism, particularly when the goal is to divert all available reductant (electrons) toward highly reduced products such as biofuels. During an analysis of the C. bescii genome sequence for oxidoreductase-type enzymes, evidence was uncovered to suggest that the primary redox metabolism of C. bescii has a completely uncharacterized aspect involving tungsten, a rarely used element in biology. An active tungsten utilization pathway in C. bescii was demonstrated by the heterologous production of a tungsten-requiring, aldehyde-oxidizing enzyme (AOR) from the hyperthermophilic archaeon Pyrococcus furiosus. Furthermore, C. bescii also contains a tungsten-based AOR-type enzyme, here termed XOR, which is phylogenetically unique, representing a completely new member of the AOR tungstoenzyme family. Moreover, in C. bescii, XOR represents ca. 2% of the cytoplasmic protein. XOR is proposed to play a key, but as yet undetermined, role in the primary redox metabolism of this cellulolytic microorganism.T hermophilic bacteria of the genus Caldicellulosiruptor are currently under intense investigation due to their ability to decompose lignocellulosic plant biomass anaerobically at high temperature, thereby potentially mitigating costly thermochemical pretreatment steps (1, 2). One of these species, Caldicellulosiruptor bescii, has an optimal growth temperature of 78°C and is the most thermophilic cellulose degrader known to date. It is able to ferment high concentrations of cellulosic feedstock primarily to hydrogen gas, lactate, acetate, and CO 2 (3, 4). Species from this genus can degrade cellulose (and also xylan), using novel multidomain glycosyl hydrolases, representing a new paradigm in cellulose conversion by anaerobic thermophiles (2). Moreover, the recent development of a genetic system for C. bescii creates potential for using this and related species for consolidated biomass processing in the production of liquid fuels (5).Developing metabolic engineering strategies for any microorganism obviously requires an in-depth understanding of their primary metabolism. Evidence that C. bescii may have a completely uncharacterized aspect to its primary redox metabolism came from an analysis of its genome sequence for molybdoenzymes (6). These are present in virtually all forms of life, serving diverse roles in primary metabolism of carbon, nitrogen and sulfur (7). As expected, we found that the C. bescii genome contains genes necessary for the synthesis of the pyranopterin cofactor that coordinates molybdenum (Mo) in such enzymes (7). Accordin...

show abstract

“…P. furiosus strain COM1, a uracil auxotrophic strain, was used as the host strain for genetic manipulation (16). This organism was transformed by the method of Lipscomb et al (13).…”

Section: Methodsmentioning

confidence: 99%

Mannosylglycerate and Di- myo -Inositol Phosphate Have Interchangeable Roles during Adaptation of Pyrococcus furiosus to Heat Stress

Esteves

Chandrayan

McTernan

et al. 2014

Appl Environ Microbiol

Self Cite

View full text Add to dashboard Cite

bMarine hyperthermophiles accumulate small organic compounds, known as compatible solutes, in response to supraoptimal temperatures or salinities. Pyrococcus furiosus is a hyperthermophilic archaeon that grows optimally at temperatures near 100°C. This organism accumulates mannosylglycerate (MG) and di-myo-inositol phosphate (DIP) in response to osmotic and heat stress, respectively. It has been assumed that MG and DIP are involved in cell protection; however, firm evidence for the roles of these solutes in stress adaptation is still missing, largely due to the lack of genetic tools to produce suitable mutants of hyperthermophiles. Recently, such tools were developed for P. furiosus, making this organism an ideal target for that purpose. In this work, genes coding for the synthases in the biosynthetic pathways of MG and DIP were deleted by double-crossover homologous recombination. The growth profiles and solute patterns of the two mutants and the parent strain were investigated under optimal growth conditions and also at supraoptimal temperatures and NaCl concentrations. DIP was a suitable replacement for MG during heat stress, but substitution of MG for DIP and aspartate led to less efficient growth under conditions of osmotic stress. The results suggest that the cascade of molecular events leading to MG synthesis is tuned for osmotic adjustment, while the machinery for induction of DIP synthesis responds to either stress agent. MG protects cells against heat as effectively as DIP, despite the finding that the amount of DIP consistently increases in response to heat stress in the nine (hyper)thermophiles examined thus far. Many thermophiles and hyperthermophiles have been isolated from marine geothermal areas and, accordingly, grow optimally in medium containing 2 to 4% (wt/vol) NaCl. Like the vast majority of halophiles, these organisms accumulate compatible solutes to balance the external osmotic pressure (1-3). However, the organisms from hot habitats accumulate unusual negatively charged solutes (sometimes designated thermolytes), which contrast with the neutral or zwitterionic nature of the solutes typical of mesophiles. Moreover, the intracellular content of solutes from (hyper)thermophiles increases not only with the NaCl concentration of the medium but also with the growth temperature, suggesting that the role of thermolytes goes beyond osmoprotection (4).Screening for new solutes in (hyper)thermophiles showed that di-myo-inositol phosphate (DIP) and mannosylglycerate (MG) are the most widespread components of the solute pools in organisms adapted to grow at temperatures above 60°C (4). Typically, heat stress conditions lead to the accumulation of DIP and DIP derivatives, while MG increases in response to a supraoptimal salinity in the growth medium; curiously, the thermophilic bacterium Rhodothermus marinus and the hyperthermophilic archaeon Palaeococcus ferrophilus, which lack DIP biosynthesis, accumulate MG to cope with heat stress (2, 5). On the other hand, Archaeoglobus fulgidus strains unable to ...

show abstract

Recombinogenic Properties of Pyrococcus furiosus Strain COM1 Enable Rapid Selection of Targeted Mutants

Cited by 50 publications

References 37 publications

Exploiting microbial hyperthermophilicity to produce an industrial chemical, using hydrogen and carbon dioxide

Exploiting microbial hyperthermophilicity to produce an industrial chemical, using hydrogen and carbon dioxide

A New Class of Tungsten-Containing Oxidoreductase in Caldicellulosiruptor, a Genus of Plant Biomass-Degrading Thermophilic Bacteria

Mannosylglycerate and Di- myo -Inositol Phosphate Have Interchangeable Roles during Adaptation of Pyrococcus furiosus to Heat Stress

Contact Info

Product

Resources

About