Real-Time Quantitative PCR Assay for Monitoring of Nervous Necrosis Virus Infection in Grouper Aquaculture

Abstract

Viral nervous necrosis caused by nervous necrosis virus (NNV) exacts a high mortality and results inhuge economic losses in grouper aquaculture in Taiwan. The present study developed a real-time quantitative PCR (qPCR) method for NNV monitoring. The assay showed a strong linear correlation (r 2 ‫؍‬ 0.99) between threshold cycle (C T ) and RNA quantities, which allowed identification of infected groupers by the C T value and could be exploited to warn of NNV infection prior to an outbreak in grouper fish farms. Real-time qPCR also confirmed the copious content of NNV in grouper fin, similar to that in primary tissues; the result was verified by using in situ reverse transcription-PCR (RT-PCR). This indicated that grouper fin was a suitable sample for NNV detection, in a manner that could be relatively benign to the fish. The rapid spread of NNV infection to the entire population of affected farms was evident. The developed real-time qPCR method is rapid, highly sensitive, and applicable to routine high-throughput detection of large numbers of samples and has potential as a suitable tool for diagnostic, epidemiological, and genetic studies of grouper aquaculture.

Mortality Caused by Bath Exposure of Zebrafish (Danio rerio) Larvae to Nervous Necrosis Virus Is Limited to the Fourth Day Postfertilization

“…All PCRs were performed with triplicate samples and were repeated at least twice. NNV cDNA was identified and quantitated by real-time PCR targeting two capsid gene fragments: an 81-bp fragment, using primers NTR f (GCCCCTGATGGAGCAGTCT) and NTR r (AGC ACGGTCAACATCTCCAGTT) (primer set 1 [9]), and a 203-bp fragment, using primers 203f (GACGCGCTTCAAGCAACTC) and 203r (CG AACACTCCAGCGACACAGCA) (primer set 2 [15]). For immune gene analyses, the following primers were used: for the Mx(a) gene, Mx f (AG TACCGGGGAAGAGAGCTA) and Mx r (AAGGTGGCATGATTGTC TGT) (9); for the interleukin 1␤ (IL-1␤) gene, IL-1␤ f (GGCTGTGTGT TTGGGAATCT) and IL-1␤ r (TGATAAACCAACCGGGACA) (16), and for the tumor necrosis factor alpha (TNF-␣) gene, TNF-␣ f (GCGCTTT TCTGAATCCTACG) and TNF-␣ r (TGCCCAGTCTGTCTCCTTCT) (16).…”

Dynamic distribution and tissue tropism of nervous necrosis virus in juvenile pompano (Trachinotus ovatus) during early stages of infection

“…The copy number below the limit of detection (dotted line) was regarded as negative sample. Lopez-Jimena et al (2011) andKuo et al (2011), was developed as a highly sensitive method for rapid detection and quantification of RGNNV. This technique was also recently applied to assess replication of other viruses within various tissues (Agarwal et al, 2013;Wang et al, 2013).…”

“…More recently, a novel genotype isolated from turbot (turbot nodavirus) was described and is pending recognition as the fifth subtype within the betanodaviruses (Johansen et al, 2004). The clinical signs of fish with NNV infections are uncoordinated or erratic swimming behavior and loss of appetite (Kuo et al, 2011). More than 40 species of fish from all continents, with the exception of Africa, that belong to the orders Anguilliformes, Perciformes, Pleuronectiformes, Tetraodontiformes, and Gadiformes are susceptible to NNV (Bovo et al, 2011).…”

“…However, this method suffers from a limited ability to quantify copy numbers of Aquaculture 440 (2015) 25-31 the viral genome in infected tissues. Detection and quantification of viral RNA by quantitative real-time polymerase chain reaction (qPCR) have become very popular due to its high sensitivity and reliable specificity (Kuo et al, 2011). Monitoring the distribution and movement of the viral genome in host tissues is of great importance to understand virus-host interactions at the earlier stages of infection as well as for development of biomarkers as early warning indicators of NNV infection prior to disease outbreak.…”

Inhibition of fish nodavirus by gymnemagenol extracted from Gymnema sylvestre

“…Nervous necrosis virus (NNV), a Nodavirus, is classified as betanodavirus of the family Nodaviridae, and has caused mass mortality of numerous marine fish species at larval stage (Kuo et al, 2011). Nodaviruses are small (25-30 nm in diameter), spherical, non-enveloped viruses with a genome that is composed of two single-stranded and positive-sense RNA molecules.…”