Rapid identification of pathogenic streptococci isolated from moribund red tilapia (Oreochromis spp.)

Abdelsalam, Mohamed; Elgendy, Mamdouh Y.; Shaalan, Mohamed; Moustafa, M. M.; Fujino, Masayuki

doi:10.1556/004.2017.005

Cited by 23 publications

(15 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Parasites are the most prevalent pathogens responsible for about 80% fish disease condition in aquaculture farms (Shaheen et al 2013). Infectious diseases caused by different strains of bacteria also occur in fish with resultant mortalities as compared to parasitic infections were also reported in Egyptian farms (Al-Shamy 2010; Aly 2013; Shaheen et al 2013;Abdelsalam et al 2017). There is insufficient information about viral infections and spread in Egypt, probably due to the lack of established surveillance program for monitoring and controlling viral infections in fish.…”

Section: Diseasesmentioning

confidence: 88%

Aquaculture in Africa: A Comparative Review of Egypt, Nigeria, and Uganda Vis-À-Vis South Africa

Babatunde

Robertson-Andersson

Gan

et al. 2020

Reviews in Fisheries Science & Aquaculture

View full text Add to dashboard Cite

This study reviews the development and conventional qualitative analysis of aquaculture in Africa, specifically by reviewing the aquaculture sector of key players (Egypt, Nigeria and Uganda) as a reference for South Africa; an aspiring key aquaculture player in Africa based on the launch of Operation Phakisa-South African version of the blue economy initiative. The key players were identified based on current annual production output and critical success factors, thus used as a benchmark for South Africa. Qualitative factors reviewed are critical success factors of the aquaculture sector of the selected countries that are widely germane to aquaculture development. These factors include production outputs (tons) and value ($); cultured species; prevalent aquaculture production systems; types of aquaculture, i.e., freshwater and mariculture; aquaculture development challenges related to fish seed, fish feed, land and water availability; aquaculture market and trade and provision of enabling environment through policies and frameworks. These factors were qualitatively reviewed and analyzed in ranking the aquaculture operations of the key players and South Africa to elucidate the critical success factors and challenges.

show abstract

Section: Diseasesmentioning

confidence: 88%

Aquaculture in Africa: A Comparative Review of Egypt, Nigeria, and Uganda Vis-À-Vis South Africa

Babatunde

Robertson-Andersson

Gan

et al. 2020

Reviews in Fisheries Science & Aquaculture

View full text Add to dashboard Cite

show abstract

“…The suspected isolates were then presumptively identified by using both conventional biochemical tests and API 20NE strips (Bio Merieux) according to manufacturer's instructions. Identification of A. hydrophila and P. aeruginosa strains was confirmed by sequencing with 16S rRNA (Abdelsalam et al., 2017), using the universal primer; Forward: (5‐AGAGTTTGATCCTGGCTCAG‐3) and Reverse: (5‐GGTTACCTTGTTACGACTT‐3) (Weisburg et al., 1991) at Sigma Scientific Services Laboratory. The nucleotide sequences have been deposited in GenBank under accession numbers and .…”

Section: Methodsmentioning

confidence: 99%

Green synthesis and physical properties of Gum Arabic‐silver nanoparticles and its antibacterial efficacy against fish bacterial pathogens

et al. 2020

Self Cite

View full text Add to dashboard Cite

This study aimed to assess the antibacterial efficacy of Gum Arabic‐based silver nanoparticles against certain fish bacterial pathogens. Silver nanoparticles were green‐synthesized using Gum Arabic (AgNPs‐GA), which served as a stabilizing and reducing agent. The AgNPs‐GA were analysed using a UV spectrophotometer set at a wavelength of 450 nm. Transmission electron micrograph analysis showed that nearly all AgNPs‐GA were sphere‐shaped and 10.0 nm in diameter. Dynamic light scattering (DLS) analysis showed a narrow size distribution curve, whose highest peak was at 26.2 nm. The particles were negatively charged (−17.1 ± 4.9 mV). Silver concentration measured by inductively coupled plasma optical emission spectrometry (ICP‐OES) and found to be 104 µg/ml. The in vitro antibacterial activity of AgNPs‐GA was tested against Aeromonas hydrophila and Pseudomonas aeruginosa. Gum Arabic‐silver nanoparticles exhibited clear inhibition zones of 22 and 20 mm against A. hydrophila and P. aeruginosa, with a minimum inhibitory concentration of 1.625 µg/ml and 3.25 µg/ml for AgNPs‐GA respectively. The antibiofilm activity indicated that AgNPs‐GA significantly inhibit A. hydrophila and P. aeruginosa biofilm formation at AgNPs‐GA concentrations of 1.625 µg/ml. There was no significant difference at a AgNPs‐GA concentration of 0.8215 µg/ml between the control‐positive groups and the AgNPs‐GA treatment groups in both bacterial strains. In summary, green‐synthesized sliver nanoparticles display efficient antibacterial properties, which suggests that they would be suitable for use in a commercialized antibacterial product for the aquaculture industry.

show abstract

“…Fish production is considered one of the most important food industries as a result of the rapid growth cycle of fish and their low price, as it is an excellent source of high‐quality protein and low saturated fat. Various infectious diseases, including those caused by bacterial, viral and parasitic pathogens, pose a serious threat to fish farming, resulting in huge losses to the fish industry (Abdelsalam et al, 2017; Taha et al, 2020). The aquaculture and fish industries are significantly threatened by digenetic trematode infections.…”

Section: Introductionmentioning

confidence: 99%

Epidemiological study of fish‐borne zoonotic trematodes infecting Nile tilapia with first molecular characterization of two heterophyid flukes

Mahdy

Abdel-Maogood

Abdelsalam

et al. 2021

Aquaculture Research

Self Cite

View full text Add to dashboard Cite

Fish‐borne zoonotic trematodes (FBZT) are extremely important zoonotically and can infect humans via the consumption of poorly cooked fish containing active metacercariae. In this context, the present study aimed to update the epidemiological information of FBZT among Nile tilapia (Oreochromis niloticus) collected from Giza and Fayoum Governorates. Concerning the molecular characterization and phylogenetic analysis of adult flukes from experimentally infected pigeons and histopathological alterations of both larval and adult trematode flukes. Oreochromis niloticus were found to be infected with different encysted metacercaria (EMC); Prohemistomum, Haplorchis and Pygidiopsis species from wild caught in Giza and farmed fish in Fayoum with the total mean of prevalence that 81.89 ± 6.48, 18.03 ± 2.9 and 34.64 ± 3.42 respectively. Three recovered flukes from experimentally infected domestic pigeons (Columba livia domestica); Prohemistomum vivax, Haplorchis pumilio and Pygidiopsis genata in their small intestine. First molecular characterization and phylogenetic analysis of heterophyid flukes; P. genata and H. pumilio. The sequences obtained in this study were registered in the GenBank with accession numbers (MT672308.1 and MT707975.1) respectively. Moreover, constructing a phylogeny and phylogenetic relationships between two heterophyid species was performed through analytic study of the second internal transcribed spacer nuclear ribosomal genes (rDNA‐ITS2). Phylogenetic analysis of P. genata and H. pumilio showed 99.42% nucleotide similarity with that sequence from Israel (AY245710) and 99.71% from Vietnam (EU826636.1). In addition, histopathological alterations of EMC and adult flukes induced necrosis of fish muscle bundles and a severe inflammatory response with muscular necrosis in intestinal tract of infected pigeons.

show abstract

Rapid identification of pathogenic streptococci isolated from moribund red tilapia (Oreochromis spp.)

Cited by 23 publications

References 24 publications

Aquaculture in Africa: A Comparative Review of Egypt, Nigeria, and Uganda Vis-À-Vis South Africa

Aquaculture in Africa: A Comparative Review of Egypt, Nigeria, and Uganda Vis-À-Vis South Africa

Green synthesis and physical properties of Gum Arabic‐silver nanoparticles and its antibacterial efficacy against fish bacterial pathogens

Epidemiological study of fish‐borne zoonotic trematodes infecting Nile tilapia with first molecular characterization of two heterophyid flukes

Contact Info

Product

Resources

About