Rapid Detection and Identification of Wuchereria bancrofti, Brugia malayi, B. pahangi, and Dirofilaria immitis in Mosquito Vectors and Blood Samples by High Resolution Melting Real-Time P

Abstract

A simple, rapid, and high-throughput method for detection and identification of Wuchereria bancrofti, Brugia malayi, Brugia pahangi, and Dirofilaria immitis in mosquito vectors and blood samples was developed using a real-time PCR combined with high-resolution melting (HRM) analysis. Amplicons of the 4 filarial species were generated from 5S rRNA and spliced leader sequences by the real-time PCR and their melting temperatures were determined by the HRM method. Melting of amplicons from W. bancrofti, B. malayi, D. immitis, and B. pahangi peaked at 81.5±0.2℃, 79.0±0.3℃, 76.8±0.1℃, and 79.9±0.1℃, respectively. This assay is relatively cheap since it does not require synthesis of hybridization probes. Its sensitivity and specificity were 100%. It is a rapid and technically simple approach, and an important tool for population surveys as well as molecular xenomonitoring of parasites in vectors.

Trypanosome infection rates in tsetse flies in the “silent” sleeping sickness focus of Bafia in the Centre Region in Cameroon

“…However, in foci where real epidemiological data are not available, the identification of trypanosomes in tsetse flies or xenomonitoring could provide data that could help to understand the current situation of human and animal Trypanosomiases since the transmission of these diseases relies mainly on tsetse flies. Xenomonitoring is gradually becoming an interesting topic in most vector-borne diseases, especially those for which the elimination is foreseen such as lymphatic filariasis [ 20 – 22 ]. The identification of trypanosomes in tsetse flies indicates an active transmission and suggests a potential risk of human infection, thereby pleading in favor to continue with disease control measures.…”

The Incidence of Dirofilaria immitis in Shelter Dogs and Mosquitoes in Austria

“…Screening for Dirofilaria spp. using PCR showed a sensitivity and specificity of 100% in various studies [ 43 , 44 , 45 ]. Therefore, false-negative results in the PCR screening are very unlikely to occur.…”

Primary SLX Test Using Real-Time PCR Based on High Resolution Melting (Hrm) on Microfilaria Examination

“…Pada tahun 2002-2015, penderita kasus filariasis mengalami kenaikan yaitu 6.571-13.032 penderita (Kementrian Kesehatan RI, 2016). Meskipun filariasis bukan penyebab pertama kematian manusia, tetapi penyakit ini dapat membuat penderita menjadi cacat atau cacat permanen (Thanchomnang et al, 2013). Pada kesepakatan global di tahun 2020 (The Global Goal of Elimination of Lymphatic Filariasis as a Public Healthproblem by The Year 2020), World Health Organization menetapkan untuk mengeliminasi filariasis.…”

“…Di Negara Thailand, B. malayi, B. pahangi dan D. immitis pada sampel darah dapat diidentifikasi dengan High Resolution Melting (HRM) berbasis PCR real-time. Pada penelitian terdahulu, pemeriksaan PCR dengan HRM menggunakan primer spesifik yaitu SLX-F (5'GGAATCCCAGGTGTTGTAGACAT3') dan SLX-R (5'GGGCTGAAACATTCAATTACCTC 3'), dirancang dari gen B. Malayi 5S rRNA dan urutan SL1 (aksesi GenBank no D87037) yang memiliki kepekaan yang baik dalam mendeteksi DNA filariasis (Thanchomnang et al, 2013). Menurut Aris et al, (2013), pemilihan primer yang tepat sangat mempengaruhi kualitas deteksi molekuler berbasis PCR.…”