Rapid and robust directed differentiation of mouse epiblast stem cells into definitive endoderm and forebrain organoids

Abstract

Directed differentiation of pluripotent stem cells (PSCs) is a powerful model system for deconstructing embryonic development. Although mice are the most advanced mammalian model system for genetic studies of embryonic development, state-of-the-art protocols for directed differentiation of mouse PSCs into defined lineages require additional steps and generate target cell types with lower purity than analogous protocols for human PSCs, limiting their application as models for mechanistic studies of development. Here, we examine the potential of mouse epiblast stem cells (EpiSCs) cultured in media containing Wnt pathway inhibitors as a starting point for directed differentiation. As a proof-of-concept, we focused our efforts on two specific cell/tissue types that have proven difficult to generate efficiently and reproducibly from mouse embryonic stem cells: definitive endoderm and neural organoids. We present new protocols for rapid generation of nearly pure definitive endoderm and forebrain-patterned neural organoids that model the development of prethalamic and hippocampal neurons. These differentiation models present new possibilities for combining mouse genetic tools with in vitro differentiation to characterize molecular and cellular mechanisms of embryonic development.

An epigenetic barrier sets the timing of human neuronal maturation

“…CHD5-KO and JADE2-KO WA09 hPSC lines were generated by the SKI Stem Cell Research Core at Memorial Sloan Kettering Cancer Center (MSKCC) via CRISPR–Cas9 using the following gRNA targets: CHD5, CGTGGACTACCTGTTCTCGG; JADE2, CAGTTTGGAGCATCTTGATG. Mouse epiblast stem cells (EpiSCs) B6.129_4 were a gift from the Vierbuchen laboratory at Memorial Sloan Kettering Cancer Center and were maintained on mouse embryonic fibroblasts as previously described 64 . Rat primary astrocytes were purchased from Lonza (R-CXAS-520) and cultured according to manufacturer instructions.…”

“…Mouse epiblast stem cells (mEpiSCs) B6.129_4 were differentiated as following: on day 0, mEpiSC colonies were lifted from feeders using 0.5 U µl −1 collagenase IV in HBSS + +, dissociated to single-cell solution using Accutase, then plated at 220,000 cells per cm 2 on Matrigel-coated wells in mN2/B27 media 64 supplemented with 10 µM Y-27632, 100 nM LDN193189, 10 µM SB431542 and 2 µM XAV939. Cells were fed daily with mN2/B27 supplemented with 2 µM XAV939 (day 1), 100 nM LDN193189 (day 1–5), 10 µM SB431542 (day 1–5).…”

Transcriptional remodeling by OTX2 directs specification and patterning of mammalian definitive endoderm

“…Accordingly, further differentiation of OTX2-depleted DE towards the foregut lineage (Fig. 2G) revealed an impairment to form clusters of SOX2 + PDX1 + gastric progenitors (Medina-Cano et al, 2022).…”

“…Human ESCs (hESCs) achieve more homogenous differentiation responses upon suitable stimulation (Hawkins et al, 2021;Loh et al, 2014;Pan et al, 2020), possibly because they resemble a post-implantation "primed" state of development (Tesar et al, 2007). Accordingly, converting naïve mESCs into a primed state allows near-homogenous, signaling-mediated differentiation into tissues such as definitive endoderm (DE), the precursor of all gut-derived organs (Medina-Cano et al, 2022). For the interrogation of protein function, in-frame fusions of degron tags such as FKBP12 F36V (referred to as the dTAG system) (Nabet et al, 2018) to proteins of interest has emerged as a powerful approach to enable acute, controlled and specific depletion of candidate factors (Jaeger and Winter, 2021;Prozzillo et al, 2020), which has been applied to address developmental questions (Abuhashem et al, 2022;Bisia et al, 2023).…”

Systematic mapping and modeling of 3D enhancer-promoter interactions in early mouse embryonic lineages reveal regulatory principles that determine the levels and cell-type specificity of gene expression

“…KH2 ESC cells were converted into EpiSC cells as previously shown 131 . Briefly, ESCs were plated on fibronectin coated plates in 50% DMEM-F12 (Thermo Fisher Scientific, 11320033), 50% Neurobasal (Thermofisher, 21103049), 0.5% N2 (Thermo, 17502048) and 1% B27 supplement (Thermo, 12587010), 2 mM glutamax (GIBCO, 15030), 100 U/ml Penicillin/100μg/ml Streptomycin (Gibco, 15140163), and 0.1% β-mercaptoethanol (SIGMA, 63689), supplemented with 12.5 ng/ml bFGF (12.5 ng/ml, Thermo ,PHG0360), 20 ng/ml Activin A (Peprotech 120-14E), and 1% Knockout Serum Replacement (Thermofisher, 10828010) .…”