Purification and characterization of a novel β‐agarase from <i>Vibrio</i> sp. AP‐2

Aoki, Takahiko; Araki, Toshimitsu; Kitamikado, Manabu

doi:10.1111/j.1432-1033.1990.tb15326.x

Cited by 103 publications

(68 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Es así como, la capacidad de degradar azúcares complejos mediante enzimas específi cas se ha reportado como una característica presente en algunas bacterias epífi tas de algas (Aoki et al, 1990;Leon et al, 1992;Hosoda et al, 2003;Fu & Kim, 2010;Kam et al, 2011;Li et al, 2011). En la literatura se pueden encontrar muchos ejemplos como la bacteria marina Saccharophagfus degradans que fue aislada desde Spartina alternifl ora en descomposición encontrada en zonas estuarinas (Ekborg et al, 2005).…”

Section: Discussionunclassified

“…Diversos autores han logrado caracterizar diversas enzimas provenientes de géneros bacterianos aislados desde ambientes mesófi los como Alteromonas, Bacillus, Cytophaga, Pseudomonas, Pseudoalteromonas, Streptomyces, Thalasomonas y Vibrio (Aoki et al, 1990;Leon et al, 1992;Parro & Mellado, 1994;Hosoda et al, 2003;Fu & Kim, 2010;Li et al, 2011;Kam et al, 2011), la mayoría de las cuales, presentan actividades máximas a temperaturas en torno a los 40-50 °C.…”

Section: Introductionunclassified

See 1 more Smart Citation

Cepa antártica de Bacillus sp., con actividad extracelular de tipo agarolítica y alginatoliasa

et al. 2013

View full text Add to dashboard Cite

RESUMENDiversas bacterias asociadas a macroalgas pueden usar fi cocoloides como fuente de carbono. Las bacterias de la Antártica, poseen características fi siológicas adaptativas que habrían evolucionado para permitir su supervivencia y funcionamiento dentro de las condiciones adversas de ese ecosistema. Por lo tanto, bacterias aisladas desde algas antárticas podrían tener la capacidad de degradar enzimáticamente azúcares complejos a temperaturas inferiores que aquellas aisladas desde zonas más cálidas, lo que potencialmente podría tener aplicaciones en la mejora en procesos industriales que utilizan enzimas. El análisis del gen ribosomal 16S indica que la cepa bacteriana aislada desde algas varadas en la Isla Rey Jorge (Antártica), pertenece al género Bacillus. El sobrenadante libre de células presentó actividad agarasa y alginatoliasa. Se encontraron diferencias signifi cativas en la temperatura óptima para hidrolizar agarosa y alginato, evaluada dentro de un rango de 4 a 30 °C. La actividad agarolítica fue mayor a 4 °C, mientras que la actividad alginatoliasa fue mayor a 30 °C. Estos resultados poseen un alto valor biotecnológico y podría ser utilizada con fi nes industriales. PALABRAS CLAVE:Bacillus, Antártica, Agarasa, Alginatoliasa. ABSTRACTSeveral bacteria associated to macroalgae can use phycocolloids as carbon source. Antarctic Bacteria's have physiological characteristics that might have evolved to allow the survival and functioning under the harsh conditions of that ecosystem. Therefore, Antarctic bacteria isolated from algae should have the ability to degrade complex sugars at lower temperatures than those isolated from warmer areas, which may have applications in the improvement of industrial processes that uses enzymes. The bacterial strain isolated from wrack algae, in King George Island, Antarctica, was identifi ed as Bacillus on the base of 16S ribosomal gene analysis. The cell-free supernatant of the culture medium showed alginate-lyase and agarase activities. Signifi cant differences in the optimal temperature to hydrolyze agarose and alginate were found within a range of 4 to 30 °C. While the agarase activity was higher at 4° C, the alginate-lyase activity was higher at 30 °C. Our results have biotechnological value and could be used with industrial aims.

show abstract

Section: Discussionunclassified

Section: Introductionunclassified

Cepa antártica de Bacillus sp., con actividad extracelular de tipo agarolítica y alginatoliasa

et al. 2013

View full text Add to dashboard Cite

show abstract

“…Many agarases published to date have been found to act on DP6 to form DP4 and DP2 but not on DP4 (1,3,8,9,12,14,16,20,22). Some other agarases have been reported to produce DP2 as the final product (2,3,11,21).…”

mentioning

confidence: 99%

“…Some other agarases have been reported to produce DP2 as the final product (2,3,11,21). Recently, Ohta et al published a ␤-agarase that did not act on DP6 (13).…”

mentioning

confidence: 99%

Cloning of the Novel Gene Encoding β-Agarase C from a Marine Bacterium, Vibrio sp. Strain PO-303, and Characterization of the Gene Product

Dong

Hashikawa

Konishi

et al. 2006

Appl Environ Microbiol

Self Cite

View full text Add to dashboard Cite

The ␤-agarase C gene (agaC) of a marine bacterium, Vibrio sp. strain PO-303, consisted of 1,437 bp encoding 478 amino acid residues. ␤-Agarase C was identified as the first ␤-agarase that cannot hydrolyze neoagarooctaose and smaller neoagarooligosaccharides and was assigned to a novel glycoside hydrolase family.Agar is a hydrophilic polysaccharide contained in the cell walls of agarophyte red algae and is composed of agarose and agaropectins (7). ␤-Agarases (EC 3.2.1.81), which hydrolyze agar, are useful tools for the preparation of neoagarooligosaccharides and the isolation of protoplasts from the algae (4). We isolated a ␤-agarase-producing bacterium, Vibrio sp. strain PO-303, from a sea environment. Among the ␤-agarases secreted by the organism, ␤-agarase C was found to be capable of forming neoagarooligosaccharides longer than neoagarohexaose (DP6) from agar (3). In this paper, we describe the cloning and expression of the ␤-agarase C gene (agaC) and the characterization of the recombinant enzyme (rAgaC).Cloning of the agaC gene. A 759-bp DNA fragment was amplified by PCR using chromosomal DNA of strain PO-303 as a template and the degenerate primers GCNAAYTAYAC NGCNWSNAAYGC and CCRTTNGCRAANACNACNGG, composed according to the N-terminal amino acid sequences of ␤-agarase C and its protease-digested fragment. Sequence analysis showed that the 759-bp fragment derived from the agaC gene. The XbaI-digested chromosomal DNA fragments were purified and self-ligated with a Takara ligation kit, version 2. The upstream and downstream regions of the 759-bp fragments were amplified by inverse PCR with the self-ligated DNA fragments as templates and two outward-facing primers designed according to the sequence given above. The PCR product was cloned into a pT7Blue-2 vector (Novagen) and sequenced. The sequencing results showed that the agaC gene consisted of 1,437 bp encoding 478 amino acid residues with a predicted molecular weight of 50,922. A potential ribosome-binding site (AGGAGA) and the Ϫ35 and Ϫ10 promoter regions were identified upstream of the coding region (15, 17). A possible transcription terminator was found downstream of the TAG termination codon. Comparison of the deduced amino acid sequence with the entries in databases suggested that ␤-agarase C might belong to a novel glycoside hydrolase (GH) family, because no known GH was found to have homology with it.Expression and purification of rAgaC. The agaC gene without the signal sequence was amplified by PCR from strain PO-303 chromosomal DNA by using primers GGTGTACAT ATGGCTAACTATACTGCCAGTAA and GCGGCCCTCG AGCTATTGGCAAGTATAACCTG, which contained artificial NdeI and XhoI sites (italicized). The amplified DNA fragment was digested with NdeI and XhoI and was ligated into a pET22b(ϩ) vector (Novagen) to construct pETAgaC. Escherichia coli BL21(DE3) strains (Novagen) harboring pETAgaC were cultivated for 12 h at 25°C in 1,000 ml of Luria-Bertani medium containing ampicillin and were induced with 1 mM isopropyl-␤-D-thiogalactopyranoside. The cells harvested by ce...

show abstract

“…Other β-agarases have been reported to produce neoagarobiose (NA2) [25,37,38] neoagarotetraose (NA4) [27,28] and neoagarohexaose (NA6) [39] as the predominant products. β-Agarase from Acinetobacter sp.…”

mentioning

confidence: 99%

Optimization of Agrase Production by Alkaline <i>Pseudomonas aeruginosa</i> ZSL-2 Using Taguchi Experimental Design

Ziayoddin

Lalitha

Shinde

2014

ILNS

View full text Add to dashboard Cite

The culture conditions for the production of extracellular agarase by Pseudomonas aeruginosa ZSL-2 were optimized using One-Factor-At-A-Time combined with orthogonal array design. OneFactor-At-A-Time method investigates the effect of time, temperature, NaCl, carbon sources, nitrogen sources and pH on agarase production. The optimized culture conditions obtained from the statistical analysis were temperature of 30 °C, pH 8.5, NH 4 NO 3 2 g L -1 and agar 3 g L -1 . The L 9 orthogonal array design was used to select the fermentation parameters influencing the yield of agarase. The order of the factors affecting the fermentation process was found to be NH 4 NO 3 > pH > agar > temperature, with temperature playing a significant role on the agarase production (p < 0.10). The higher yields than those in basal media culture were obtained in the final optimized medium with activity of 0.439 ± 0.013 U ml -1 . Extracellular agarase hydrolysed agar into a range of oligosaccharides which were analysed by LC-ESI-MS spectrometry as anhydrogalactose, galactose, agarobiose, agarotetrose and agarohexaose.

show abstract

Purification and characterization of a novel β‐agarase from Vibrio sp. AP‐2

Cited by 103 publications

References 16 publications

Cepa antártica de Bacillus sp., con actividad extracelular de tipo agarolítica y alginatoliasa

Cepa antártica de Bacillus sp., con actividad extracelular de tipo agarolítica y alginatoliasa

Cloning of the Novel Gene Encoding β-Agarase C from a Marine Bacterium, Vibrio sp. Strain PO-303, and Characterization of the Gene Product

Optimization of Agrase Production by Alkaline <i>Pseudomonas aeruginosa</i> ZSL-2 Using Taguchi Experimental Design

Contact Info

Product

Resources

About