Twelve strains (the largest number ever reported) of group C and G 1 streptococci (GCS and GGS, respectively) that caused streptococcal toxic shock syndrome (STSS) were collected and characterized. Eleven strains were identified as Streptococcus dysgalactiae subsp. equisimilis, and one strain was identified as Streptococcus equi subsp. zooepidemicus. We found that it was the first reported case of STSS caused by S. equi subsp. zooepidemicus. Cluster analysis according to the 16S rRNA gene (rDNA) sequences revealed that the S. dysgalactiae strains belonged to clusters I and II, both of which were closely related. The emm types and the restriction patterns of chromosomal DNA measured by pulsed-field gel electrophoresis were highly variable in these strains except BL2719 and N1434. The 16S rDNA sequences and other characteristics of these two strains were indistinguishable, suggesting the clonal dissemination of this particular S. dysgalactiae strain in Japan. As the involvement of superantigens in the pathogenesis of group A streptococcus-related STSS has been suggested, we tried to detect known streptococcal superantigens in GCS and GGS strains. However, only the spegg gene was detected in seven S. dysgalactiae strains, with none of the other superantigen genes being detected in any of the strains. However, the sagA gene was detected in all of the strains except Tokyo1291. In the present study no apparent factor(s) responsible for the pathogenesis of STSS was identified, although close genetic relationships of GCS and GGS strains involved in this disease were suggested.

Streptococcal toxic shock syndrome (STSS) is a re-emerging infectious disease in Japan and many other developed countries. Epidemiological studies have revealed that the M1 serotype of Streptococcus pyogenes is the most dominant causative isolate of STSS. Recent characterization of M1 isolates revealed that the mutation of covS, one of the two-component regulatory systems, plays an important role in STSS by altering protein expression. We analyzed the M1 S. pyogenes clinical isolates before or after 1990 in Japan, using two-dimensional gel electrophoresis (2-DE) and pulsed-field gel electrophoresis (PFGE). PFGE profiles were different between the isolates before and after 1990. Markedly different profiles among isolates after 1990 from STSS and pharyngitis patients were detected. Sequence analysis of two-component regulatory systems showed that covS mutations were detected not only in STSS but also in three pharyngitis isolates, in which proteins from the culture supernatant displayed the invasive type. The mutated CovS detected in the pharyngitis isolates had impaired function on the production of streptococcal pyrogenic exotoxin B (SpeB) analyzed by 2-DE. These results suggest that several covS mutations that lead to the malfunction of the CovS protein occurred even in pharyngeal infection.

SummaryWe have reported previously that Lactobacillus casei ssp. casei , together with specific substrate dextran, exhibited an adjuvant effect of stimulating humoral immune responses against bovine serum albumin (

Glycine is the simplest amino acid and is used as a metabolic product in some bacteria. However, an excess of glycine inhibits the growth of many bacteria, and it is used as a nonspecific antiseptic agent due to its low level of toxicity in animals. The effect of glycine on Helicobacter pylori is not precisely known. The present study was conducted to investigate (i) the effect of glycine on clarithromycin (CLR)-resistant and -susceptible strains of H. pylori, (ii) the effect of glycine in combination with amoxicillin (AMX), and (iii) the postantibiotic effect (PAE). The MIC at which 90% of strains are inhibited for glycine was almost 2.5 mg/ml for 31 strains of H. pylori, including CLR-resistant strains. We constructed isogenic CLR-resistant mutant strains by natural transformation and investigated the difference between clinical wild-type strains and isogenic mutants. There were no differences in the MICs between CLR-resistant and -susceptible strains or between clinical wild-type and mutant strains. The combination of AMX and glycine showed synergistic activity, with the minimum bactericidal concentration of AMX with glycine decreasing to 1/10 that of AMX alone. Glycine showed no PAE against H. pylori. These results suggest that glycine may be a useful antimicrobial agent against H. pylori not only alone but also in combination with antibacterial drugs for the treatment of H. pylori-associated diseases. Glycine may represent a component of a new type of eradication therapy for CLR-resistant H. pylori.

We studied the development of atopic dermatitis-like skin lesions in NC/Nga mice and the allergic symptoms and blood patterns of healthy volunteers during the cedar (Cryptomeria japonica) pollen season in Japan following oral administration of a new synbiotic, Lactobacillus casei subsp. casei together with dextran. The combination of L. casei subsp. casei and dextran significantly decreased clinical skin severity scores and total immunoglobulin E levels in sera of NC/Nga mice that had developed picryl chloride-induced and Dermatophagoides pteronyssinus crude extract-swabbed atopic dermatitis-like skin lesions. During the most common Japanese cedar pollen season, synbiotic L. casei subsp. casei and dextran in humans led to no significant changes in total nasal and ocular symptom scores, in the levels of cedar pollen-specific immunoglobulin E, interferon-gamma and thymus and activation regulated chemokine or in the number of eosinophils in sera, whereas the placebo group showed a tendency for increased levels of cedar pollen-specific immunoglobulin E, thymus and activation regulated chemokine and number of eosinophils, and a decrease in interferon-gamma levels. Thus, the oral administration of synbiotic L. casei subsp. casei together with dextran appears to be an effective supplement for the prevention and treatment of allergic reactions.

No abstract

A ␤-1,3-xylanase gene (txyA) from a marine bacterium, Alcaligenes sp. strain XY-234, has been cloned and sequenced. txyA consists of a 1,410-bp open reading frame that encodes 469 amino acid residues with a calculated molecular mass of 52,256 Da. The domain structure of the ␤-1,3-xylanase (TxyA) consists of a signal peptide of 22 amino acid residues, followed by a catalytic domain which belongs to family 26 of the glycosyl hydrolases, a linker region with one array of DGG and six repeats of DNGG, and a novel carbohydrate-binding module (CBM) at the C terminus. The recombinant TxyA hydrolyzed ␤-1,3-xylan but not other polysaccharides such as ␤-1,4-xylan, carboxymethylcellulose, curdlan, glucomannan, or ␤-1,4-mannan. TxyA was capable of binding specifically to ␤-1,3-xylan. The analysis using truncated TxyA lacking either the N-or C-terminal region indicated that the region encoding the CBM was located between residues 376 and 469. Binding studies on the CBM revealed that the K d and the maximum amount of protein bound to ␤-1,3-xylan were 4.2 M and 18.2 mol/g of ␤-1,3-xylan, respectively. Furthermore, comparison of the enzymatic properties between proteins with and without the CBM strongly indicated that the CBM of TxyA plays an important role in the hydrolysis of ␤-1,3-xylan.

The ␤-agarase C gene (agaC) of a marine bacterium, Vibrio sp. strain PO-303, consisted of 1,437 bp encoding 478 amino acid residues. ␤-Agarase C was identified as the first ␤-agarase that cannot hydrolyze neoagarooctaose and smaller neoagarooligosaccharides and was assigned to a novel glycoside hydrolase family.Agar is a hydrophilic polysaccharide contained in the cell walls of agarophyte red algae and is composed of agarose and agaropectins (7). ␤-Agarases (EC 3.2.1.81), which hydrolyze agar, are useful tools for the preparation of neoagarooligosaccharides and the isolation of protoplasts from the algae (4). We isolated a ␤-agarase-producing bacterium, Vibrio sp. strain PO-303, from a sea environment. Among the ␤-agarases secreted by the organism, ␤-agarase C was found to be capable of forming neoagarooligosaccharides longer than neoagarohexaose (DP6) from agar (3). In this paper, we describe the cloning and expression of the ␤-agarase C gene (agaC) and the characterization of the recombinant enzyme (rAgaC).Cloning of the agaC gene. A 759-bp DNA fragment was amplified by PCR using chromosomal DNA of strain PO-303 as a template and the degenerate primers GCNAAYTAYAC NGCNWSNAAYGC and CCRTTNGCRAANACNACNGG, composed according to the N-terminal amino acid sequences of ␤-agarase C and its protease-digested fragment. Sequence analysis showed that the 759-bp fragment derived from the agaC gene. The XbaI-digested chromosomal DNA fragments were purified and self-ligated with a Takara ligation kit, version 2. The upstream and downstream regions of the 759-bp fragments were amplified by inverse PCR with the self-ligated DNA fragments as templates and two outward-facing primers designed according to the sequence given above. The PCR product was cloned into a pT7Blue-2 vector (Novagen) and sequenced. The sequencing results showed that the agaC gene consisted of 1,437 bp encoding 478 amino acid residues with a predicted molecular weight of 50,922. A potential ribosome-binding site (AGGAGA) and the Ϫ35 and Ϫ10 promoter regions were identified upstream of the coding region (15, 17). A possible transcription terminator was found downstream of the TAG termination codon. Comparison of the deduced amino acid sequence with the entries in databases suggested that ␤-agarase C might belong to a novel glycoside hydrolase (GH) family, because no known GH was found to have homology with it.Expression and purification of rAgaC. The agaC gene without the signal sequence was amplified by PCR from strain PO-303 chromosomal DNA by using primers GGTGTACAT ATGGCTAACTATACTGCCAGTAA and GCGGCCCTCG AGCTATTGGCAAGTATAACCTG, which contained artificial NdeI and XhoI sites (italicized). The amplified DNA fragment was digested with NdeI and XhoI and was ligated into a pET22b(ϩ) vector (Novagen) to construct pETAgaC. Escherichia coli BL21(DE3) strains (Novagen) harboring pETAgaC were cultivated for 12 h at 25°C in 1,000 ml of Luria-Bertani medium containing ampicillin and were induced with 1 mM isopropyl-␤-D-thiogalactopyranoside. The cells harvested by ce...