Profiling of Up-Regulated Genes Response to Acute Hypo-Osmotic Stress in Hepatopancreas and Gill of the Pacific White Shrimps (Litopenaeus vannamei)

Abstract

Suppression subtractive hybridization (SSH) was applied to screen responsively up-regulation genes in hepatopancreas and gill of Litopenaeus vannamei induced by acute hypo-osmotic stress. In the hepatopancreas, 196 clones were randomly selected and sequenced. 131 non-redundant transcripts, corresponding to 41 genes, were found with elevated expressions. They were functionally clustered into eight biological processes which were protein synthesis and processing, carbohydrate metabolism and energy production, transport, cell growth, apoptosis, cytoskeletal component, cell defense and homeostasis, signal transduction, accounting for 26.2%, 14.3%, 16.7%, 4.7%, 4.7%, 2.3%, 11.9% and 7.1%, respectively. When confirmed by real time qRT-PCR, the gene expression levels of MnSOD, glutathione and glutamine synthetase showed significant increases (2.64-folds, 3.44-folds and 2.16-folds, respectively) in hepatopancreas (P<0.05). Totally 81 expressed sequence tags (ESTs) were obtained by random sequencing from the gill SSH cDNA library, and 52 unigenes, including 15 contigs and 37 singlets, after CP3 online matching were gained by clustering and assembling. The sequence alignment results revealed that 30 of them had significant homology to previously identified Genbank database sequences, while 22 unigenes did not match any sequence in the datebase and presumably represented unidentified cDNAs. Functionally, the unigenes were classified into six clusters, including ion channels and transport proteins (1); protein synthesis, translation and transcription factor (2); stress resistance and antioxidant factors (3); energy metabolism (4); signal receptor and transduction (5); cell fibrin and cytoskeletal proteins (6) with proportion of 23.3%, 20.0%, 20.0%, 16.7%, 10.0% and 10.0% respectively. Real time qRT-PCR confirmation revealed significant elevation of Arginine kinase, Carbonic anhydrase and NaK-ATPase-α-subunit expressions (3.73-folds, 2.55-folds and 5.83-folds, respectively) in the gill after acute low-osmotic stress (P < 0.05). These results provided insight into critical physiology processes and pathways constituting the hypo-osmotic stress adaption program in hepatopancreas and gill of L. vannamei.

A data‐independent acquisition (DIA) assay library for quantitation of environmental effects on the kidney proteome of Oreochromis niloticus

“…Three different GST isoforms are connected in network 1 to another highly regulated protein, elongation factor 1‐delta (FC = 4.48, p = .0025). EF 1‐delta was found to be regulated in several studies of fish exposed to pollutants (Jeffries et al, 2015; Williams et al, 2003) and putative disease agents (Lü et al, 2014), as well as hypo‐osmotic stress in shrimp (Liu et al, 2016).…”

“…Three different GST isoforms are connected in network 1 to another highly regulated protein, elongation factor 1-delta (FC = 4.48, p = .0025). EF 1-delta was found to be regulated in several studies of fish exposed to pollutants (Jeffries et al, 2015;Williams et al, 2003) and putative disease agents (Lü et al, 2014), as well as hypo-osmotic stress in shrimp (Liu et al, 2016 (Elarabany et al, 2017). Osmotic stress is known to induce erythrocyte cell death by opening Ca 2+ -permeable cation channels, increasing cytosolic Ca 2+ activity and triggering erythrocyte apoptosis (Lang et al, 2003).…”

A data-independent acquisition (DIA) assay library for quantitation of environmental effects on the kidney proteome of Oreochromis niloticus

“…Three different GST isoforms are connected in network 1 to another highly regulated protein, elongation factor 1-delta (FC=4.48, p=.0025). EF 1-delta was found to be regulated in several studies of fish exposed to pollutants (Jeffries, Brander, Britton, Fangue, & Connon, 2015;Williams, Gensberg, Minchin, & Chipman, 2003) and putative disease agents (Lü et al, 2014), as well as hypo-osmotic stress in shrimp (Liu et al, 2016).…”

Changes of Ammonia-Metabolizing Enzyme Activity and Gene Expression of Two Strains in Shrimp Litopenaeus vannamei Under Ammonia Stress

“…The extraction of total RNA and reverse transcription, as well as the qRT-PCR, were performed per the methods of our previously paper (Wei et al, 2016 ). GDH -β, GS and TG were determined for each cDNA using qRT-PCR on a ROCHE Light Cycler 96 Real-Time Cycler PCR Detection System (Roche Applied Science, Mannheim, Germany) using the following specific primers, Forward/Reverse sequence for GDH -β (5'−3') (CTTTCCAGGATCGCATTTCT; AAGCAG CAGTACGGAGATCAA) and GS (GGCATGGAGCAGGAGTA; CGCCGCAGT AGTAGGGT); for TG (CCTCAGGATCTCCTTCACCA; TTGGGAAAACCTTCA TTTCG); as well as the β-actin (CGCGACCTCACAGACTACCT, GTGGTCATC TCCTGCTCGAA) (Li and Wormhoudt, 2015 ; Liu et al, 2016 ). The thermal cycling conditions for the qRT-PCR consisted of denaturation at 95°C for 15 min, followed by 40 cycles at 95°C for 15 s, 60°C for 30 s then a final hold at 60°C for 60 s (Wang et al, 2010 ).…”

“…As a primary environmental factor, ammonia-N can rapidly increase mortality and lead to severe economic losses in shrimp cultivation industry (Cobo et al, 2014 ). Previous studies have also shown that various tissues of L. vannamei had been seriously affected when exposed to different ammonia stress levels (Racotta and Hernández-Herrera, 2000 ; Liang et al, 2016 ; Liu et al, 2016 ; Zhou et al, 2017 ).…”