Productive Human Immunodeficiency Virus Type 1 Infection in Peripheral Blood Predominantly Takes Place in CD4/CD8 Double-Negative T Lymphocytes

Kaiser, Philipp; Joos, Béda; Niederöst, Barbara; Weber, Rainer; Günthard, Huldrych F.; Fischer, Marek

doi:10.1128/jvi.00492-07

Cited by 70 publications

(118 citation statements)

References 78 publications

Supporting

Mentioning

108

Contrasting

Order By: Relevance

“…Latently infected cells (L 1 and L 2 ) were assumed to transcribe HIV-1 RNA at low or intermediate levels [12,13]. Infected cells that are HIV-1 DNA positive, but HIV-1 RNA negative, were assumed to remain transcriptionally silent during the observation period and considered as defectively infected cells…”

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

Quantifying the turnover of transcriptional subclasses of HIV-1-infected cells

Althaus

Joos

Perelson

et al. 2013

Preprint

Self Cite

View full text Add to dashboard Cite

HIV-1-infected cells in peripheral blood can be grouped into different transcriptional subclasses. Quantifying the turnover of these cellular subclasses can provide important insights into the viral life cycle and the generation and maintenance of latently infected cells. We used previously published data from five patients chronically infected with HIV-1 that initiated combination antiretroviral therapy (cART).Patient-matched PCR for unspliced and multiply spliced viral RNAs combined with limiting dilution analysis provided measurements of transcriptional profiles at the single cell level. Furthermore, measurement of intracellular transcripts and extracellular virion-enclosed HIV-1 RNA allowed us to distinguish productive from non-productive cells. We developed a mathematical model describing the dynamics of plasma virus and the transcriptional subclasses of HIV-1-infected cells. Fitting the model to the data allowed us to better understand the phenotype of different transcriptional subclasses and their contribution to the overall turnover of HIV-1 before and during cART. The average number of virus-producing cells in peripheral blood is small during chronic infection (25.7 cells ml −1 ). We find that 14.0%, 0.3% and 21.2% of infected cells become defectively, latently and persistently infected cells, respectively. Assuming that the infection is homogenous throughout the body, we estimate an average in vivo viral burst size of 2.1 × 10 4 virions per cell. Our study provides novel quantitative insights into the turnover and develop-

show abstract

Section: Resultsmentioning

confidence: 99%

“…The study identified four distinct viral transcriptional classes: two overlapping cell classes of high viral transcriptional activity, representative of a virus producing phenotype; and two cell classes that express HIV-1 RNA at low and intermediate levels that match definitions of viral latency [12,13].…”

mentioning

confidence: 99%

Quantifying the turnover of transcriptional subclasses of HIV-1-infected cells

Althaus

Joos

Perelson

et al. 2013

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…Because of down regulation of CD4 by HIV-1, cells actively producing virus are seen as CD4/CD8 double-negative T cells (Kaiser et al 2007). In cell culture HIV-1 infects activated cells with much greater efficiency than quiescent cells (Korin and Zack 1998), with central and effector memory cells as the primary targets (Pfaff et al 2010).…”

Section: Target Cells T-cell Subsetsmentioning

confidence: 99%

HIV-1 Pathogenesis: The Virus

Swanstrom

Coffin

2012

Cold Spring Harbor Perspectives in Medicine

110

View full text Add to dashboard Cite

“…Experiments were done in duplicate using the real-time thermocycler IQ5 (BioRad, Basel) and as cycling profile: 95°C 15', 60x (95°C 5'', 55°C 5'', 60°C 40''). The following primers were used; cr1 (TCTCTGGCTAACTAGGGAACCCACTGCTT) (Lewin et al, 1999) and cr2 (TGACTAAAAGGGTCTGAGGGATCTCTAGTTACCAG) (Lewin et al, 1999) for the early region, ts5'gag (CAAGCAGCCATGCAAATGTTAAAAGA) (Kaiser et al, 2007) and skcc (TACTAGTAGTTCCTGCTATGTCACTTCC) (Christopherson et al, 2000) for the gag region, mf209…”

Section: Pcr and Signal To Noise Ratiosmentioning

confidence: 99%

“…DNA qPCR was performed as described previously (Kaiser et al, 2007) using HotStarTaq Master Mix (Qiagen), 1uM of each primer and 0.1uM FH-probe. Experiments were done in duplicate using the real-time thermocycler IQ5 (BioRad, Basel) and as cycling profile: 95°C 15', 60x (95°C 5'', 55°C 5'', 60°C 40'').…”

Section: Pcr and Signal To Noise Ratiosmentioning

confidence: 99%