Production of Infectious Swine Vesicular Disease Virus from Cloned cDNA in Mammalian Cells

An Attenuating Mutation in the 2A Protease of Swine Vesicular Disease Virus, a Picornavirus, Regulates Cap- and Internal Ribosome Entry Site-Dependent Protein Synthesis

“…The primers used were 1D-exp F (dCCGAATTCACCATGGAAC AAAAACTCATCTCAGAAGAGGATCTGGGGCCCCCAGGAGAGGTG; 62-mer) and 2A-exp R (dCCGGATCCTTATTGCTCCATGGCATCGTCCT CC; 33-mer). The full-length infectious cDNA plasmid for the 00 strain (15) and cDNA generated by reverse transcription of the virulent J1 viral RNA, with 2A-exp R as the primer, were used as templates. The fragments were ligated into vector pGEM-T (Promega) and introduced into Escherichia coli (strain JM109).…”

“…Full-length infectious cDNA clones corresponding to both the virulent J1Ј73 strain (termed J1) and the avirulent H/3Ј76 strain (termed 00) of SVDV have been isolated (15,18). The viruses recovered from these plasmids retain the biological characteristics of their parental viruses (18).…”

Importance of Arginine 20 of the Swine Vesicular Disease Virus 2A Protease for Activity and Virulence

“…Analysis of 2A mutations within full-length infectious cDNA of SVDV. In order to examine the effects of the mutations at residue 20 of the 2A protease on the properties of SVDV, nine representative mutant cDNAs that had shown a range of different activities in the assays described above were reconstructed into the full-length infectious cDNA (pSVLS00) derived from the attenuated H/3/76 (00) strain (20). The individual mutant full-length cDNAs were sequenced to check for the presence of the expected mutations and then transfected into COS-7 cells to rescue the viruses.…”

Infective viruses produced from full-length complementary DNA of swine vesicular disease viruses HK/70 strain

“…Since the first infectious cDNA clone of poliovirus [12] was constructed, many cDNA copies from RNA genomes of members of the Picornaviridae have been obtained. For example, full-length cDNA copies constructed from two Japanese SVDV strains (J1′73 and H/3′76) [11,17] were used to study virulence differences between the two strains [20] . A full-length cDNA clone of the European SVDV NET/1/92 strain isolated in the 1990s [18] was also constructed.…”

“…Analogically, it might therefore be possible to get a live attenuated vaccine for SVD. Three infectious cDNA clones of SVDV have been established, but these cDNA clones were based on H/3′76 [17] , J′73 [11] and NET/1/92 [18] . J1′73 and H/3′76 were isolated from Japan, and NET/1/92 was isolated from Netherlands.…”