PRIMA: a rapid and cost-effective genotyping method to detect single-nucleotide differences using probe-induced heteroduplexes

Kakui, Hiroyuki; Yamazaki, Misako; Shimizu, Kentaro

doi:10.1038/s41598-021-99641-x

Cited by 9 publications

(7 citation statements)

References 49 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The frameshift of rdp1-3 and rdp1-6 were identical. These frameshift mutants were genotyped by PRIMA using primers (Forward primer, 5′–TAGGCACAATGGAAAGTTAG–3′; Reverse primer, 5′–TT AACATAAAAGAACCATTGTAAG–3′) and 40-mer probe (5′–GGAGACTTTGTAGATACCAGAGTTCATCTTCTGCAGAAC G–3′) as described previously ( Kakui et al, 2021 ). T-DNA fragments containing CRISPR/Cas9 and GFP marker were removed from each strain of rdp1-3 and rdp1-6 by selecting non-fluorescence seeds ( Tsutsui and Higashiyama, 2017 ).…”

Section: Methodsmentioning

confidence: 99%

Pollen Number and Ribosome Gene Expression Altered in a Genome-Editing Mutant of REDUCED POLLEN NUMBER1 Gene

et al. 2022

Self Cite

View full text Add to dashboard Cite

The number of pollen grains varies within and between species. However, little is known about the molecular basis of this quantitative trait, in contrast with the many studies available on cell differentiation in the stamen. Recently, the first gene responsible for pollen number variation, REDUCED POLLEN NUMBER1 (RDP1), was isolated by genome-wide association studies of Arabidopsis thaliana and exhibited the signature of natural selection. This gene encodes a homolog of yeast Mrt4 (mRNA turnover4), which is an assembly factor of the large ribosomal subunit. However, no further data were available to link ribosome function to pollen development. Here, we characterized the RDP1 gene using the standard A. thaliana accession Col-0. The frameshift mutant, rdp1-3 generated by CRISPR/Cas9 revealed the pleiotropic effect of RDP1 in flowering, thus demonstrating that this gene is required for a broad range of processes other than pollen development. We found that the natural Col-0 allele conferred a reduced pollen number against the Bor-4 allele, as assessed using the quantitative complementation test, which is more sensitive than transgenic experiments. Together with a historical recombination event in Col-0, which was identified by sequence alignment, these results suggest that the coding sequence of RDP1 is the candidate region responsible for the natural phenotypic variation. To elucidate the biological processes in which RDP1 is involved, we conducted a transcriptome analysis. We found that genes responsible for ribosomal large subunit assembly/biogenesis were enriched among the differentially regulated genes, which supported the hypothesis that ribosome biogenesis is disturbed in the rdp1-3 mutant. Among the pollen-development genes, three key genes encoding basic helix-loop-helix (bHLH) transcription factors (ABORTED MICROSPORES (AMS), bHLH010, and bHLH089), as well as direct downstream genes of AMS, were downregulated in the rdp1-3 mutant. In summary, our results suggest a specialized function of ribosomes in pollen development through RDP1, which harbors natural variants under selection.

show abstract

Section: Methodsmentioning

confidence: 99%

Pollen Number and Ribosome Gene Expression Altered in a Genome-Editing Mutant of REDUCED POLLEN NUMBER1 Gene

et al. 2022

Self Cite

View full text Add to dashboard Cite

show abstract

“…Heteroduplex Mobility Assay (HMA) can also distinguish between the heteroduplexes and homoduplexes DNA in native PAGE but indels smaller than 3 bp in size can be missed 11 , 12 . Improved versions of the HMA called improved heteroduplex analysis (iHDA) 13 and Probe-Induced HMA (PRIMA) 14 use DNA probes to detect 1-bp pair indels after gene editing. Though these techniques can detect a wide range of indels, they does involve multiple steps.…”

Section: Introductionmentioning

confidence: 99%

“…Alternatively, probes can be purchased to save time but the fee for a 200-nucleotide oligo is relatively expensive. PRIMA solves this problem by making use of shorter probes; however, it requires additional PCR step before hybridization with the probes 14 . With additional PCR step, there will also be the need of pre-testing of PCR products.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

A pair of primers facing at the double-strand break site enables to detect NHEJ-mediated indel mutations at a 1-bp resolution

Ijaz

Nakazato

Setou

et al. 2022

Sci Rep

View full text Add to dashboard Cite

The introduction of small insertion/deletion (indel) mutations in the coding region of genes by the site-specific nucleases such as Cas9 allows researchers to obtain frameshift null mutants. Technically simple and costly reasonable genotyping methods are awaited to efficiently screen the frameshift null mutant candidates. Here, we developed a simple genotyping method called DST-PCR (Double-strand break Site-Targeted PCR) using “face-to-face” primers where the 3’ ends of forward and reverse primers face each other at the position between 3-bp and 4-bp upstream of the PAM sequence, which is generally the Cas9-mediated double-strand break site. Generated amplicons are directly subjected to TBE-High-Resolution PAGE, which contains a high concentration of bis-acrylamide, for mutant clones detection with 1-bp resolution. We present actual cases of screening of CRISPR/Cas9-engineered knockout (KO) cells for six genes, where we screen indels to obtain potential KO cell clones utilizing our approach. This method allowed us to detect 1-bp to 2-bp insertion and 1-bp to 4-bp deletion in one or both alleles of mutant cell clones. In addition, this technique also allowed the identification of heterozygous and homozygous biallelic functional KO candidates. Thus, DST-PCR is a simple and fast method to screen KO candidates generated by the CRISPR/Cas9 system before the final selection of clones with sequencing.

show abstract

“…Heteroduplex Mobility Assay (HMA) can also distinguish between the heteroduplexes and homoduplexes DNA in native PAGE [11,12]. Moreover, improved versions of the HMA called improved heteroduplex analysis (iHDA) [13] and Probe-Induced HMA (PRIMA) [14] use DNA probes to detect 1-bp pair insertions after gene editing. A weak point of these methods is that they require special equipment and might need skilled techniques for optimizations.…”

Section: Introductionmentioning

confidence: 99%

A pair of primers facing at the double-strand break site enables to detect NHEJ-mediated indel mutations at a 1-bp resolution

Ijaz

Nakazato

Setou

et al. 2022

Preprint

View full text Add to dashboard Cite

The introduction of small insertion/deletion (indel) mutations in the coding region of genes by the site-specific nucleases such as Cas9 allows researchers to obtain frameshift null mutants. Technically simple and costly reasonable genotyping methods are awaited to efficiently screen the frameshift null mutant candidates. Here, we developed a simple genotyping method called DST-PCR (Double-strand break Site-Targeted PCR) using "face-to-face" primers where the 3` ends of forward and reverse primers face each other at the position between 3-bp and 4-bp upstream of the PAM sequence, which is generally the Cas9-mediated double-strand break site. Generated amplicons are directly subjected to TBE-High-Resolution PAGE, which contains a high concentration of bis-acrylamide, for mutant clones detection with 1-bp resolution. We demonstrate six examples of CRISPR/Cas9-engineered knockout cells, to screen indels to obtain potential KO cell clones utilizing our approach. This method allowed us to detect 1-bp to 2-bp insertion and 1-bp to 4-bp deletion in one or both alleles of mutant cell clones. In addition, this technique also allowed the identification of heterozygous and homozygous biallelic functional KO candidates. Thus, DST-PCR coupled with TBE-High-Resolution PAGE is a simple method for genotyping of the CRISPR/Cas9-engineered cell lines, which can be performed without special equipment and techniques.

show abstract

PRIMA: a rapid and cost-effective genotyping method to detect single-nucleotide differences using probe-induced heteroduplexes

Cited by 9 publications

References 49 publications

Pollen Number and Ribosome Gene Expression Altered in a Genome-Editing Mutant of REDUCED POLLEN NUMBER1 Gene

Pollen Number and Ribosome Gene Expression Altered in a Genome-Editing Mutant of REDUCED POLLEN NUMBER1 Gene

A pair of primers facing at the double-strand break site enables to detect NHEJ-mediated indel mutations at a 1-bp resolution

A pair of primers facing at the double-strand break site enables to detect NHEJ-mediated indel mutations at a 1-bp resolution

Contact Info

Product

Resources

About