Prevalence of enterotoxin-encoding genes among diverse Shigella strains isolated from patients with diarrhea, southwest Iran

Abstract

Shigella spp. are a major cause of bacillary dysentery, particularly among children in developing countries such as Iran. This study aimed to investigate the presence of two important Shigella enterotoxins (ShET-1 and ShET-2), encoded by the set and sen genes, respectively, by polymerase chain reaction (PCR) assay among Shigella species isolated from children affected by shigellosis in Ahvaz, southwest of Iran. In this cross-sectional study, from June 2016 to April 2017, altogether 117 Shigella isolates were collected from fecal specimens of children aged <15 years with diarrhea in Ahvaz, southwest Iran. All isolates were identified by standard microbiological and molecular methods. The presence of enterotoxin genes was determined by PCR. The most prevalent isolate was Shigella flexneri (47.9%), followed by Shigella sonnei (41%) and Shigella boydii (11.1%), respectively. Shigella dysenteriae was not detected in patients' samples. The frequencies of set1A, set1B, and sen genes were 5.1% (6/117), 15.4% (18/117), and 76.9% (90/117), respectively. This study provides initial background on the prevalence and distribution of the Shigella enterotoxin genes in Shigella isolates in southwest of Iran. In addition, this study revealed a high prevalence of sen enterotoxin gene in Shigella species.

Investigation of SCCmec types I–IV in clinical isolates of methicillin-resistant coagulase-negative staphylococci in Ahvaz, Southwest Iran

“…DNA extraction was done by the boiling method [14]. The isolates were cultured on nutrient agar (Merck, Darmstadt, Germany) incubated at 37 • C for 24 h. The bacterial suspension was prepared in microtubes containing 500 μl TE (10 mM Tris/HCl, 1 mM EDTA, pH 8.0).…”

“…Staphylococcus epidermidis and Staphylococcus haemolyticus are identified as the most common species isolated from clinical samples [2]. [14] tuf-R CCATTTCAGTACCTTCTGGTAA mecA-F TCCAGATTACAACTTCACCAGG mecA 162 [15] mecA-R CCACTTCATATCTTGTAACG 1272F1 GCCACTCATAACATATGGAA IS1272 415 [16] 1272R1 CATCCGAGTGAAACCCAAA β ATTGCCTTGATAATAGCCYTCT ccrA2-B 937 [16] α3 TAAAGGCATCAATGCACAAACACT IS1272 CGTCTATTACAAGATGTTAAGGATAAT ccrC 518 [16] ccrCR CCTTTATAGACTGGATTATTCAAAATAT (MDR) isolates (resistant to three or more of antimicrobials) were estimated according to previously described definitions [13]. Staphylococcus aureus ATCC 29213 and ATCC 33591 were used as control strains.…”

Evaluation of the phytoconstituents of Auricularia auricula-judae mushroom and antimicrobial activity of its protein extract

“…A total of 10 microbial isolates comprising of Gram-positive bacteria ( Staphylococcus aureus , Bacillus subtilis ), Gram-negative bacteria ( Escherichia coli , Pseudomonas aeruginosa , Klebsiella pneumoniae ), yeast ( Candida albicans ) and dermatophytic pathogens ( Trichophyton schoenleinii, Trichophyton mentagrophytes, Microsporum gypseum, and Microsporum ferugineum ), previously collected from clinical samples in the postgraduate laboratory of the Department of Pharmaceutical Microbiology and Biotechnology, Faculty of Pharmaceutical Sciences, Nnamdi Azikiwe University, were used in this study. Each of the collected isolates was re-identified and confirmed using the standard protocols as described in the literature [ [19] , [20] , [21] , [22] , [23] , [24] , [25] ].…”

Molecular Mechanisms of Shigella Pathogenesis; Recent Advances

“…This exotoxin is an iron-dependent toxin (55 KDa), mainly released by S. flexneri strains, and predominantly accounts for the early phase of diarrhoea in shigellosis. ShET2 is a plasmid-borne toxin (inv plasmid) encoded by the senB gene and also responsible for the early phase of diarrhoea [12,71,72]. Other toxins have also been described for the Shigella species, including protein involved in intestinal colonisation and Shigella IgA-like protease homology toxins encoded by pic and sigA genes, respectively.…”