Prediction of Response to Pegylated Interferon plus Ribavirin byIL28BGene Variation in Patients Coinfected with HIV and Hepatitis C Virus

Abstract

IL28B gene variations independently predict SVR in HIV/HCV-coinfected patients with HCV genotype 1 and non-genotype 1 HCV infection. The association between rs12979860 and plasma low-density lipoprotein cholesterol suggests that the system low-density lipoprotein ligand/receptor might be involved in the effect of this genotype.

Complexity and Catalytic Efficiency of Hepatitis C Virus (HCV) NS3 and NS4A Protease Quasispecies Influence Responsiveness to Treatment with Pegylated Interferon plus Ribavirin in HCV/HIV-Coinfected Patients

“…For subtype 1b, oligonucleotides HCVproL2 (sense, 5Ј-GGGTTGAATTCTAT GGCTCCTATTGGATCTGTTGTTATTGTTGGAAGAATTATTTTGTCTG GAAGAGGAGGACCTATCACGGCCTACTCCCAA-3Ј, residues 3414 to 3434 of the HCV-J strain) and HCVproR (antisense, 5Ј-GGGAGGGGCTCG AGTCAAGACCGCATAGTAGTTTCCAT-3Ј, residues 3933 to 3952 of the HCV-J strain) were used. The PCR products were digested with EcoRI and XhoI and ligated to pBSK (Stratagene) to generate a ␤-gal-HCV NS3 2-181 /4 [21][22][23][24][25][26][27][28][29][30][31][32][33][34] protease fusion protein (pHCVNS3 2-181 /4 21-34 protease). To ensure that multiple NS3/4 protease templates were present in each quasispecies that was analyzed, four different PCR amplifications were performed for each sample and pooled before cloning.…”

“…The resulting PCR products were digested with NsiI and HindIII and ligated to pcI.HCVNS4B/NS5Acro previously digested with NsiI and HindIII. Escherichia coli JM109 cells containing plasmid pcI.Cardifcro were then transformed with plasmid pHCVNS3 2-181 /4 [21][22][23][24][25][26][27][28][29][30][31][32][33][34] protease. Transformed cells were grown overnight at 30°C in the presence of 0.2% maltose-12.5 g/ml of tetracycline-20 g/ml of ampicillin, harvested by centrifugation, and resuspended to an optical density at 600 nm of 2.0/ml in 10 mM MgSO 4 .…”

“…Transformed cells were grown overnight at 30°C in the presence of 0.2% maltose-12.5 g/ml of tetracycline-20 g/ml of ampicillin, harvested by centrifugation, and resuspended to an optical density at 600 nm of 2.0/ml in 10 mM MgSO 4 . To induce the expression of HCV NS3 2-181 /4 [21][22][23][24][25][26][27][28][29][30][31][32][33][34] protease, cells (20 l) were incubated in 100 l of Luria-Bertani (LB) medium containing 12.5 g/ml tetracycline, 20 g/ml ampicillin, 0.2% maltose, 10 mM MgSO 4 , and 0.1 mM isopropyl-␤-D-thiogalactopyranoside (IPTG) for 1 h. The cell cultures were then infected with 10 5 PFU of phage. After 3 h at 37°C, the titer of the resulting phage was determined by coplating the cultures with 200 l of E. coli XL-1 Blue cells (adjusted to an optical density at 600 nm of 2.0/ml in 10 mM MgSO 4 ) on LB plates using 3 ml of top agar containing 12.5 g of tetracycline/ml, 0.2% maltose, and 0.1 mM IPTG.…”

HIV Co-Infections with Hepatitis B and C

“…Genome-wide association studies have identified several single nucleotide polymorphisms (SNPs) around the IL28B gene (which codes for IFN-lambda 3) which are strongly associated with treatment induced viral clearance of genotype 1 infection in HIV/HCV coinfected patients (i.e. IL28B genotype CC) [120,121]. IL28B TT/CT genotypes are associated with poorer response to IFN based treatment.…”

Interleukin 28B Polymorphisms and Hepatitis C—Translating the Association into Clinical Decision Making

“…35,49 In patients with recurrent HCV after orthotopic liver transplantation, IL28B polymorphisms allow prediction of SVR to PEG-IFN/RBV therapy. 50,51 The value of IL28B polymorphisms have also been shown to predict response to triple therapy, including the directly acting antiviral drug telaprevir along with PEG-IFN/RBV.…”