Population genetics and evolutionary demography of Ucides cordatus (Decapoda: Ocypodidae)

Abstract

Variation in a fragment of the mitochondrial control region was investigated to assess the population history of the mangrove land crab, Ucides cordatus L., based on 100 individuals from five locations throughout the Brazilian coast. There was considerable variability in the studied fragment, with every individual showing a distinct haplotype. When regions of ambiguous alignment were removed, 90 haplotypes were still recognized, of which only 1 was shared among locations. There was no statistically significant evidence for geographical structure in the pattern of genetic variability based on a nested clade analysis, even though the geographical distances among the farthest collection sites exceeded 3000 km. Moreover, the mismatch distribution of pairwise differences showed a smooth unimodal distribution that is consistent with a recent population expansion of U. cordatus, either when each location was analysed in isolation or when all samples were combined. Interestingly, the estimates for the duration of such expansion vary latitudinally, suggesting that the expansion of the population of U. cordatus proceeded in a southward direction. These results indicate a possible relationship between the growth in the population of the mangrove land crab and the dynamics of mangrove ecosystems during the Quaternary.

Large‐scale connectivity of Grapsus grapsus (Decapoda) in the Southwestern Atlantic oceanic islands: integrating genetic and morphometric data

“…The primers DLUSSAF1 (5′–GTATAACCGCGAATGCTGGCAC–3′) and ILEUCAR3 (5′–GCTAYCCTTTTAAATCAGGCAC–3′) (Oliveira‐Neto et al . ) were used to amplify a 570‐bp fragment of the mitochondrial DNA control region. Amplification was carried out in 25‐μl reactions with 1.25 units AmpliTaq DNA polymerase, 1× PCR buffer, 2 m m MgCl 2 , 0.4 m m of deoxynucleotide solution mix (dNTPs) and 0.5–1.0 μ m of each primer (25 pmol).…”

Genetic homogeneity and historical expansions of the slipper lobster, Scyllarides brasiliensis, in the south-west Atlantic

“…with Lutjanus purpureus: Gomes et al 2012;Scomberomorus cavalla: Santa-Brígida et al 2007;Ocyurus chrysurus: Vasconcellos et al 2008; Farfantepenaeus brasiliensis and Litopenaeus schmitti: Gusmão et al 2005; Ucides cordatus: Oliveira-Neto et al 2007; Cardisoma guanhumi : Oliveira-Neto et al 2008).…”

Extreme homogeneity and low genetic diversity in Kryptolebias ocellatus from south-eastern Brazil suggest a recent foundation for this androdioecious fish population

“…The South African population also has very low genetic diversity in what otherwise is a highly polymorphic species. Another such example may be even more relevant to the current discussion: a mangrove land crab Ucides cordatus whose range overlaps that of K. marmoratus–K.ocellatus and likewise is associated with the mangrove habitat is thought to have undergone a dramatic southward expansion with concomitant losses of variation along the way (Oliveira‐Neto et al , 2007).…”