Polymorphism of GSTM1 and GSTT1 genes in bladder cancer: a study from North India

Srivastava, Daya Shankar Lal; Kumar, Anant; Mittal, Balraj; Mittal, Rama Devi

doi:10.1007/s00204-004-0559-y

Cited by 30 publications

(18 citation statements)

References 34 publications

(32 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Conversely, other studies have reported increased risk in women but not men, and among women, only among smokers (6), as well as no overall association with increased risk (7). Associations between the GSTT1 null variant and overall increased risk were reported by some investigators (7) but not others (6), and among women but not men (7). Similarly, studies of the association of the variant GPX1 genotype with bladder cancer reported inconsistent findings (8, 9).…”

Section: Discussionmentioning

confidence: 78%

GSTM1, GSTT1 Null Variants, and GPX1 Single Nucleotide Polymorphism Are Not Associated with Bladder Cancer Risk in Egypt

Goerlitz

El-Daly²,

Abdel‐Hamid³

et al. 2011

Cancer Epidemiology, Biomarkers &Amp; Prevention

View full text Add to dashboard Cite

Background Bladder cancer is the most common male malignancy in Egypt, consists predominantly of urothelial cell (UC) and squamous cell (SCC) carcinoma, and disparities in incidence exist between men and women regardless of geographic region. Tobacco smoke exposure and Schistosoma haematobium (SH) infection and the presence of GSTM1, GSTT1, and GPX1 genotypes, as modulators of the carcinogenic effect of reactive oxidative species (ROS), were hypothesized to modify bladder cancer risk and possibly explain these gender differences. Methods We evaluated the association between bladder cancer risk and functional polymorphisms in the GSTM1, GSTT1, and GPX1 genes in 625 cases and 626 matched population-based controls in Egypt, and assessed for potential interactions between these candidate genes and environmental exposures such as smoking and SH. We analyzed the risk for UC and SCC separately. Results None of these functional polymorphisms were significantly associated with bladder cancer risk. There were no significant interactions between genotypes and smoking or SH in this population, nor was any difference detected in genotypic risk between men and women. Conclusions Our findings suggest that common genetic variations in GSTM1, GSTT1, and GPX1 are not associated with bladder cancer risk overall, and that well known environmental risk factors, such as smoking and SH do not interact with these genes to modulate the risk. Impact Our data indicate that common genetic variations in GSTM1, GSTT1, and GPX1 were not associated with bladder cancer risk.

show abstract

Section: Discussionmentioning

confidence: 78%

GSTM1, GSTT1 Null Variants, and GPX1 Single Nucleotide Polymorphism Are Not Associated with Bladder Cancer Risk in Egypt

Goerlitz

El-Daly²,

Abdel‐Hamid³

et al. 2011

Cancer Epidemiology, Biomarkers &Amp; Prevention

View full text Add to dashboard Cite

show abstract

“…Entering age, smoking (never, former, current), or total urinary arsenic as categorical variables had no impact on the results. Because several previous studies showed that gender differences in GST or MTHFR activity may exist (Egaas et al, 1995;Hoensch et al, 2002;Srivastava et al, 2004;Verma & Rana, 2003), separate analyses were performed in men and women. All analyses were carried out using SAS 8.0e (SAS Institute, Cary, NC).…”

Section: Methodsmentioning

confidence: 99%

Genetic Polymorphisms in MTHFR 677 and 1298, GSTM1 and T1, and Metabolism of Arsenic

Steinmaus¹,

Moore²,

Shipp³

et al. 2007

Journal of Toxicology and Environmental Health, Part A

View full text Add to dashboard Cite

Methylation is the primary route of metabolism of inorganic arsenic in humans, and previous studies showed that interindividual differences in arsenic methylation may have important impacts on susceptibility to arsenic-induced cancer. To date, the factors that regulate arsenic methylation in humans are mostly unknown. Urinary arsenic methylation patterns and genetic polymorphisms in methylenetetrahydrofolate reductase (MTHFR) and glutathione S-transferase (GST) were investigated in 170 subjects from an arsenic-exposed region in Argentina. Previous studies showed that subjects with the TT/AA polymorphisms at MTHFR 677 and 1298 have lower MTHFR activity than others. In this study, it was found that subjects with the TT/AA variant of MTHFR 677/1298 excreted a significantly higher proportion of ingested arsenic as inorganic arsenic and a lower proportion as dimethylarsinic acid. Women with the null genotype of GSTM1 excreted a significantly higher proportion of arsenic as monomethylarsonate than women with the active genotype. No associations were seen between polymorphisms in GSTT1 and arsenic methylation. This is the first study to report (1) associations between MTHFR and arsenic metabolism in humans, and (2) gender differences between genetic polymorphisms and urinary arsenic methylation patterns. Overall, this study provides evidence that MTHFR and GSTM1 are involved in arsenic metabolism in humans, and polymorphisms in the genes that encode these enzymes may play a role in susceptibility to arsenic-induced cancer.

show abstract

“…The GSTM1 polymorphism was identified using a multiplex PCR method described previously 21 . The following primers were used to amplify the target fragments containing the GSTM1 polymorphism previously described: 5′‐ GAACTCCCT GAAAAGCTAAAGC ‐3′ (forward) and 5′‐ CAACTTCATCCACGTTCACC ‐3′ (reverse) for the GSTM1 polymorphism; and 5′‐CAACTTCATCCACGTTCACC‐3′ and 5′‐GAAGAGCCAAGGACAGGTAC‐3′ for β‐globin as an internal control 16 . The 410‐bp PCR product contains the CYP2E1 and the 215‐bp PCR product contains the GSTM1 null genotype when the β‐globin specific 268‐bp product.…”

Section: Methodsmentioning

confidence: 99%

“…Epidemiological studies have investigated the association between CYP2E1 ‐1019T>A polymorphism and risk of bladder cancer, but the results were conflicted 13–15 . Two studies reported that GSTM1 null genotype is a risk factor for bladder cancer 16,17 . However, recent studies found that the GSTM1 polymorphism is not associated with risk of bladder cancer 18 …”

Section: Introductionmentioning

confidence: 99%

Genetic variants of the cytochrome P450 and glutathione S‐transferase associated with risk of bladder cancer in a south‐eastern Chinese population

Shao¹,

Gu²,

Zhang³

et al. 2008

Int J of Urology

View full text Add to dashboard Cite

Objective: To evaluate the association between genetic polymorphisms of CYP2E1 RsaI and GSTM1 and development of bladder cancer in a south-eastern Han Chinese population. Methods: We hypothesized that the CYP2E1-1019T>A and GSTM1 polymorphisms were associated with risk of bladder cancer. In a hospitalbased case-control study of 202 case patients with newly diagnosed bladder transitional cell carcinoma and 272 cancer-free controls frequencymatched by the age and sex, we genotyped these two polymorphisms using a polymerase chain reaction-restriction fragment length polymorphism method. Results: We found that the GSTM1 null genotype was associated with an increased risk of bladder cancer (adjusted odds ratio [OR] = 1.73, 95% confidence interval [CI] = 1.17-2.56) compared with those with the non-null genotype, but the CYP2E1-1019T>A polymorphisms did not show any association. In the stratification analysis of the GSTM1 polymorphism, we found that the increased risk was more pronounced among subgroups aged Յ60 years (OR = 2.02, 95% CI = 1.08-3.77), smokers (OR = 1.94, 95% CI = 1.11-3.38) and non-drinkers (OR = 3.86, 95% CI = 1.28-11.60). Conclusion: GSTM1 polymorphism (but not CYP2E1 RsaI polymorphism) appears to contribute to the etiology of bladder cancer in a southeastern Chinese population.

show abstract

Polymorphism of GSTM1 and GSTT1 genes in bladder cancer: a study from North India

Cited by 30 publications

References 34 publications

GSTM1, GSTT1 Null Variants, and GPX1 Single Nucleotide Polymorphism Are Not Associated with Bladder Cancer Risk in Egypt

GSTM1, GSTT1 Null Variants, and GPX1 Single Nucleotide Polymorphism Are Not Associated with Bladder Cancer Risk in Egypt

Genetic Polymorphisms in MTHFR 677 and 1298, GSTM1 and T1, and Metabolism of Arsenic

Genetic variants of the cytochrome P450 and glutathione S‐transferase associated with risk of bladder cancer in a south‐eastern Chinese population

Contact Info

Product

Resources

About