Physiology of Mycoplasmas

Razin, Shmuel

doi:10.1016/s0065-2911(08)60086-7

Cited by 81 publications

(83 citation statements)

References 267 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1, together with the sequences of E. coi (12) and B. subtiZis (13) 5S rRNAs for comparison. (16). The G+C contents of most of the genes in Mycoplaema must be low, because the average G+C content of the genome DNA is only 25% (14).…”

Section: (3) Sequence Analyses By Post Labelling Proceduresmentioning

confidence: 99%

See 1 more Smart Citation

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum

Hori¹,

Sawada²,

Osawa³

et al. 1981

Nucl Acids Res

View full text Add to dashboard Cite

The nucleotide sequence of 5S rRNA from Mycoplasma capricoiwn is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUAAGCUCUAUW ACGGUGAAGAUAUW A CUGAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria. INTRODUCTIONThe mycoplasmas, that have been well known as one of the smallest selfreplicating organisms (1), have a genome of 0.67 x 109 daltons in size (onequarter as large as E. coZi) (2), which includes only two rRNA cistrons (3).

show abstract

Section: (3) Sequence Analyses By Post Labelling Proceduresmentioning

confidence: 99%

“…There exists some exceptions for this. For example, M. capricolwn tRNAs have 53% G+C (16), and the initiator tRNA of M. mycoides sp. capri has 68% G+C (17).…”

Section: (3) Sequence Analyses By Post Labelling Proceduresmentioning

confidence: 99%

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum

Hori¹,

Sawada²,

Osawa³

et al. 1981

Nucl Acids Res

View full text Add to dashboard Cite

show abstract

“…The organisms were grown in 100 to 500 ml of a modified Edward medium (1) containing either 2% PPLO-serum fraction (Difco) or 0.5% fatty-acidpoor bovine serum albumin (BSA). The latter medium was supplemented with 5 to 15 ,ug of oleic acid per liter (cis-A9-C18) or elaidic (trans-AW-C,8) acid with or without 15 Zg of myristoleic acid per liter (CiS-A9-C14). Cerulenin, kindly provided by S. Omura (Kitasato Institute, Tokyo, Japan), was added to the medium as an ethanolic solution to a final concentration of up to 100 ,ug/ml.…”

Section: Methodsmentioning

confidence: 99%

“…Since mycoplasmas are capable of incorporating exogenous fatty acids, and thus enabling us to manipulate changes in their lipid composition (14,15), the study of these organisms has provided a considerable amount of information on the molecular organization of membrane lipids (16). The most widely studied mycoplasma for this purpose is Acholeplasma laidlawii.…”

mentioning

confidence: 99%

Effect of Cerulenin on Growth and Lipid Metabolism of Mycoplasmas

Rottem

Barile

1976

Antimicrob Agents Chemother

View full text Add to dashboard Cite

Cerulenin markedly inhibited the growth of Acholeplasma laidlawii. A. axanthum and A. granularum were less susceptible, whereas the sterol-requiring Mycoplasma species examined showed very little susceptibility. The inhibition was not reversed by the addition of long-chain fatty acids to the medium. At a concentration of 20 ug/ml, cerulenin inhibited the incorporation of ['4C]acetate into A. laidlawii membrane lipids, but it had no effect on either protein or nucleic acid biosynthesis. Cerulenin inhibited both the de novo synthesis of longchain fatty acids and the elongation of medium-chain fatty acids. As a result, carotenoid biosynthesis was stimulated, and increased amounts of oleic and elaidic acids were incorporated into membrane polar lipids. Our studies support the concept that cerulenin can serve as a useful tool for obtaining better control of fatty acid composition of A. laidlawii membranes.

show abstract

“…Others have recently been detected in the sea. No estimate of the number of PPLO organisms detected on estuarine detritus or marine environments has yet been made (Razin, 1970;Smith, 1964), but their contributions to the microbial mass appear to be minimal.…”

Section: ) Viability Of Organisms Detected By Direct Countsmentioning

confidence: 99%